FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636078_at:

>probe:Drosophila_2:1636078_at:554:541; Interrogation_Position=216; Antisense; GGTTGGCTACTCCTATGCAAGATTC
>probe:Drosophila_2:1636078_at:168:305; Interrogation_Position=227; Antisense; CCTATGCAAGATTCGAGGGTCCGGT
>probe:Drosophila_2:1636078_at:161:553; Interrogation_Position=261; Antisense; GGAGCATCTGGTCACCGTCCACGAC
>probe:Drosophila_2:1636078_at:337:147; Interrogation_Position=299; Antisense; ACTATGTGGCCCGTCCCGAGTACAG
>probe:Drosophila_2:1636078_at:244:491; Interrogation_Position=318; Antisense; GTACAGCTTCGCCTATGGAGTCGAG
>probe:Drosophila_2:1636078_at:174:105; Interrogation_Position=350; Antisense; AGACGCGCGTGCTGCAGAATCGCAA
>probe:Drosophila_2:1636078_at:343:667; Interrogation_Position=409; Antisense; TACAGCGTAGTCGATCCGGATGGCA
>probe:Drosophila_2:1636078_at:369:547; Interrogation_Position=426; Antisense; GGATGGCACCTTGCGTGTGGTTAAA
>probe:Drosophila_2:1636078_at:719:587; Interrogation_Position=443; Antisense; TGGTTAAATACACGGCCGACGATGC
>probe:Drosophila_2:1636078_at:62:345; Interrogation_Position=473; Antisense; GCTTCCAAGCCGAGGTCATTACCAA
>probe:Drosophila_2:1636078_at:262:511; Interrogation_Position=502; Antisense; GTGAAAACTCTGCACGGCCACGGTT
>probe:Drosophila_2:1636078_at:605:519; Interrogation_Position=553; Antisense; GTGGACAGCCAGGTGAGGCACCATA
>probe:Drosophila_2:1636078_at:250:579; Interrogation_Position=649; Antisense; GGCCAGTACCAAGTGCACGAGGATT
>probe:Drosophila_2:1636078_at:174:501; Interrogation_Position=760; Antisense; GTCGAGGCAGATGCTCACAGTCAGC

Paste this into a BLAST search page for me
GGTTGGCTACTCCTATGCAAGATTCCCTATGCAAGATTCGAGGGTCCGGTGGAGCATCTGGTCACCGTCCACGACACTATGTGGCCCGTCCCGAGTACAGGTACAGCTTCGCCTATGGAGTCGAGAGACGCGCGTGCTGCAGAATCGCAATACAGCGTAGTCGATCCGGATGGCAGGATGGCACCTTGCGTGTGGTTAAATGGTTAAATACACGGCCGACGATGCGCTTCCAAGCCGAGGTCATTACCAAGTGAAAACTCTGCACGGCCACGGTTGTGGACAGCCAGGTGAGGCACCATAGGCCAGTACCAAGTGCACGAGGATTGTCGAGGCAGATGCTCACAGTCAGC

Full Affymetrix probeset data:

Annotations for 1636078_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720