Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636081_at:

>probe:Drosophila_2:1636081_at:125:643; Interrogation_Position=4765; Antisense; TCACCCCTACCGCAGCAGGAAGTAA
>probe:Drosophila_2:1636081_at:398:325; Interrogation_Position=4811; Antisense; GCGTCCCGCTCCACGAAGAAGAGTA
>probe:Drosophila_2:1636081_at:564:203; Interrogation_Position=4829; Antisense; AAGAGTACAGAACAAGCCCCTCCGG
>probe:Drosophila_2:1636081_at:613:161; Interrogation_Position=4854; Antisense; ACAATCGCCTGGAGTGTCCTGCAAA
>probe:Drosophila_2:1636081_at:616:611; Interrogation_Position=4873; Antisense; TGCAAACGCGGACCAGGACGACCTC
>probe:Drosophila_2:1636081_at:654:179; Interrogation_Position=4903; Antisense; AAAACCGCCACACCAATCAGTCGGG
>probe:Drosophila_2:1636081_at:487:269; Interrogation_Position=4959; Antisense; CATGGGTCCATTGCTGGTGCCTCTG
>probe:Drosophila_2:1636081_at:442:373; Interrogation_Position=4988; Antisense; GAAGTCCAGATGACACGCCGCCCAG
>probe:Drosophila_2:1636081_at:392:523; Interrogation_Position=5033; Antisense; GGGCGCCCAGTCCTTTATCGGGATC
>probe:Drosophila_2:1636081_at:247:699; Interrogation_Position=5046; Antisense; TTTATCGGGATCTCATGGTGCCGTC
>probe:Drosophila_2:1636081_at:328:589; Interrogation_Position=5061; Antisense; TGGTGCCGTCGGTCCAGAGTAGTTA
>probe:Drosophila_2:1636081_at:522:501; Interrogation_Position=5072; Antisense; GTCCAGAGTAGTTACCCAAAACAGT
>probe:Drosophila_2:1636081_at:659:143; Interrogation_Position=5192; Antisense; ACTGCAAGTGCAAACATCCTGAAAT
>probe:Drosophila_2:1636081_at:251:629; Interrogation_Position=5208; Antisense; TCCTGAAATTCGGTATAAAGCTCTA

Paste this into a BLAST search page for me
TCACCCCTACCGCAGCAGGAAGTAAGCGTCCCGCTCCACGAAGAAGAGTAAAGAGTACAGAACAAGCCCCTCCGGACAATCGCCTGGAGTGTCCTGCAAATGCAAACGCGGACCAGGACGACCTCAAAACCGCCACACCAATCAGTCGGGCATGGGTCCATTGCTGGTGCCTCTGGAAGTCCAGATGACACGCCGCCCAGGGGCGCCCAGTCCTTTATCGGGATCTTTATCGGGATCTCATGGTGCCGTCTGGTGCCGTCGGTCCAGAGTAGTTAGTCCAGAGTAGTTACCCAAAACAGTACTGCAAGTGCAAACATCCTGAAATTCCTGAAATTCGGTATAAAGCTCTA

Full Affymetrix probeset data:

Annotations for 1636081_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime