FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636082_at:

>probe:Drosophila_2:1636082_at:705:593; Interrogation_Position=294; Antisense; TGGGCAAGCGTGTGCGCAGTCTCAC
>probe:Drosophila_2:1636082_at:203:533; Interrogation_Position=339; Antisense; GGGTGATGCGCCAATTAGCCAGGAT
>probe:Drosophila_2:1636082_at:342:609; Interrogation_Position=367; Antisense; TGAGCTCGAACTGTGCATCGTCAGC
>probe:Drosophila_2:1636082_at:582:327; Interrogation_Position=428; Antisense; GCGTACGCCATTGAGTGCCTCTTTG
>probe:Drosophila_2:1636082_at:488:51; Interrogation_Position=478; Antisense; ATGCGTCCAAGCGAGCGGCGAACTG
>probe:Drosophila_2:1636082_at:496:213; Interrogation_Position=519; Antisense; AAGAGCAGACTGACTGCGATCTCTG
>probe:Drosophila_2:1636082_at:164:627; Interrogation_Position=548; Antisense; TCCAACATGTGCAAGGGCTCCGTGA
>probe:Drosophila_2:1636082_at:305:29; Interrogation_Position=598; Antisense; ATACGAGCGCTTGATCTATGTGGGC
>probe:Drosophila_2:1636082_at:671:25; Interrogation_Position=624; Antisense; ATAGTTGCAACGATCTGTGCGCCAT
>probe:Drosophila_2:1636082_at:532:507; Interrogation_Position=640; Antisense; GTGCGCCATTAAGCGGCTGCGGCAA
>probe:Drosophila_2:1636082_at:209:623; Interrogation_Position=657; Antisense; TGCGGCAAAAGGATGTCGCCTGCAT
>probe:Drosophila_2:1636082_at:154:287; Interrogation_Position=770; Antisense; CTGGAGGAGCTCCTGATGCCCAAAA
>probe:Drosophila_2:1636082_at:158:625; Interrogation_Position=786; Antisense; TGCCCAAAATCGTGGCGTAGAGTTT
>probe:Drosophila_2:1636082_at:424:233; Interrogation_Position=830; Antisense; AATGCTGCTGTTTTATTCGACTTAA

Paste this into a BLAST search page for me
TGGGCAAGCGTGTGCGCAGTCTCACGGGTGATGCGCCAATTAGCCAGGATTGAGCTCGAACTGTGCATCGTCAGCGCGTACGCCATTGAGTGCCTCTTTGATGCGTCCAAGCGAGCGGCGAACTGAAGAGCAGACTGACTGCGATCTCTGTCCAACATGTGCAAGGGCTCCGTGAATACGAGCGCTTGATCTATGTGGGCATAGTTGCAACGATCTGTGCGCCATGTGCGCCATTAAGCGGCTGCGGCAATGCGGCAAAAGGATGTCGCCTGCATCTGGAGGAGCTCCTGATGCCCAAAATGCCCAAAATCGTGGCGTAGAGTTTAATGCTGCTGTTTTATTCGACTTAA

Full Affymetrix probeset data:

Annotations for 1636082_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720