FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636084_at:

>probe:Drosophila_2:1636084_at:364:185; Interrogation_Position=1180; Antisense; AAAATGCCAGCCCATGTCTGCACAG
>probe:Drosophila_2:1636084_at:376:245; Interrogation_Position=1212; Antisense; CAATATCTAATGTTGTCTACGGCAA
>probe:Drosophila_2:1636084_at:393:699; Interrogation_Position=1261; Antisense; TTTTGCCCGATTTCTGTGTCCTTCA
>probe:Drosophila_2:1636084_at:382:211; Interrogation_Position=734; Antisense; AAGAACGACTGCTTCGGCGATCGGG
>probe:Drosophila_2:1636084_at:128:575; Interrogation_Position=749; Antisense; GGCGATCGGGCTACTACAAGCTGAT
>probe:Drosophila_2:1636084_at:40:399; Interrogation_Position=778; Antisense; GACACCACCGACGAGACGGTCAAGT
>probe:Drosophila_2:1636084_at:14:537; Interrogation_Position=795; Antisense; GGTCAAGTCTCTGTTCAACGCCAAG
>probe:Drosophila_2:1636084_at:219:589; Interrogation_Position=821; Antisense; TGGAGGAGATCCTGTTCCCAACCAG
>probe:Drosophila_2:1636084_at:267:203; Interrogation_Position=840; Antisense; AACCAGCTAGACGACTCGGCGGTTC
>probe:Drosophila_2:1636084_at:695:575; Interrogation_Position=855; Antisense; TCGGCGGTTCCGATTGAAACTTTGA
>probe:Drosophila_2:1636084_at:467:431; Interrogation_Position=878; Antisense; GAGTAAACTGCAGTCCAACACTAAT
>probe:Drosophila_2:1636084_at:214:655; Interrogation_Position=899; Antisense; TAATTGCCTTTATCTACTCTGCCAG
>probe:Drosophila_2:1636084_at:103:479; Interrogation_Position=964; Antisense; GTTTCAATTGTTTGGCTTGGCAGCT
>probe:Drosophila_2:1636084_at:324:275; Interrogation_Position=979; Antisense; CTTGGCAGCTTTTTATGGCCGCATT

Paste this into a BLAST search page for me
AAAATGCCAGCCCATGTCTGCACAGCAATATCTAATGTTGTCTACGGCAATTTTGCCCGATTTCTGTGTCCTTCAAAGAACGACTGCTTCGGCGATCGGGGGCGATCGGGCTACTACAAGCTGATGACACCACCGACGAGACGGTCAAGTGGTCAAGTCTCTGTTCAACGCCAAGTGGAGGAGATCCTGTTCCCAACCAGAACCAGCTAGACGACTCGGCGGTTCTCGGCGGTTCCGATTGAAACTTTGAGAGTAAACTGCAGTCCAACACTAATTAATTGCCTTTATCTACTCTGCCAGGTTTCAATTGTTTGGCTTGGCAGCTCTTGGCAGCTTTTTATGGCCGCATT

Full Affymetrix probeset data:

Annotations for 1636084_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720