FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636085_at:

>probe:Drosophila_2:1636085_at:356:247; Interrogation_Position=1002; Antisense; CAATGCTAAGCTCCGGTCTGTGCGA
>probe:Drosophila_2:1636085_at:340:499; Interrogation_Position=1017; Antisense; GTCTGTGCGATGTCCAACGGCTGGT
>probe:Drosophila_2:1636085_at:98:483; Interrogation_Position=1058; Antisense; GTAGGTCTCGGCACAGACGTTTCGG
>probe:Drosophila_2:1636085_at:466:525; Interrogation_Position=1084; Antisense; GGGAAACTCCGTCTCGATTCAGGAC
>probe:Drosophila_2:1636085_at:564:337; Interrogation_Position=1114; Antisense; GCTCCGCGCATTGGACGTGTCAAAA
>probe:Drosophila_2:1636085_at:364:597; Interrogation_Position=1266; Antisense; TGTCCCTCGATCACTTGACCGGAAA
>probe:Drosophila_2:1636085_at:6:607; Interrogation_Position=1281; Antisense; TGACCGGAAACTTTGCTCTAGGGAA
>probe:Drosophila_2:1636085_at:379:727; Interrogation_Position=1322; Antisense; TTGGTGGATGTCAGCGTCGTCGATA
>probe:Drosophila_2:1636085_at:727:499; Interrogation_Position=1337; Antisense; GTCGTCGATAAACCCTTGCGGAGGC
>probe:Drosophila_2:1636085_at:282:551; Interrogation_Position=1381; Antisense; GGAGAAGTTCATTTACACAGGCAGT
>probe:Drosophila_2:1636085_at:623:257; Interrogation_Position=1396; Antisense; CACAGGCAGTGACCGCAACATTGTA
>probe:Drosophila_2:1636085_at:483:695; Interrogation_Position=1426; Antisense; TTTCGTGGCCGGCAAGCGTATTAAA
>probe:Drosophila_2:1636085_at:34:431; Interrogation_Position=1464; Antisense; GAGTCACAGAGCAGTTCTACCTTTA
>probe:Drosophila_2:1636085_at:54:503; Interrogation_Position=987; Antisense; GTCCCACTTCGAACACAATGCTAAG

Paste this into a BLAST search page for me
CAATGCTAAGCTCCGGTCTGTGCGAGTCTGTGCGATGTCCAACGGCTGGTGTAGGTCTCGGCACAGACGTTTCGGGGGAAACTCCGTCTCGATTCAGGACGCTCCGCGCATTGGACGTGTCAAAATGTCCCTCGATCACTTGACCGGAAATGACCGGAAACTTTGCTCTAGGGAATTGGTGGATGTCAGCGTCGTCGATAGTCGTCGATAAACCCTTGCGGAGGCGGAGAAGTTCATTTACACAGGCAGTCACAGGCAGTGACCGCAACATTGTATTTCGTGGCCGGCAAGCGTATTAAAGAGTCACAGAGCAGTTCTACCTTTAGTCCCACTTCGAACACAATGCTAAG

Full Affymetrix probeset data:

Annotations for 1636085_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720