Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636086_at:

>probe:Drosophila_2:1636086_at:58:695; Interrogation_Position=1108; Antisense; TTTCCGCCCTACCACGTGAGAATAG
>probe:Drosophila_2:1636086_at:346:435; Interrogation_Position=1141; Antisense; GAGGATCTCCTTCGCGGTGACCAGA
>probe:Drosophila_2:1636086_at:296:447; Interrogation_Position=1167; Antisense; GATCCTGGGCATGCGAAACGAATTC
>probe:Drosophila_2:1636086_at:531:189; Interrogation_Position=1195; Antisense; AACTTTGATGGAGCTTTCCGGGCGC
>probe:Drosophila_2:1636086_at:362:697; Interrogation_Position=1235; Antisense; TTTACCTGATTGACGATCCCAACGA
>probe:Drosophila_2:1636086_at:565:253; Interrogation_Position=1254; Antisense; CAACGAGCTGTACGATCTGCGCAAC
>probe:Drosophila_2:1636086_at:703:459; Interrogation_Position=1329; Antisense; GATTAAAACCCAGCAGCGACACTTT
>probe:Drosophila_2:1636086_at:396:537; Interrogation_Position=1373; Antisense; GGTCTAAGGATCTCTGCTTCTTCGA
>probe:Drosophila_2:1636086_at:290:303; Interrogation_Position=1427; Antisense; CCGATTCGATTTACTGGGAGTCCAT
>probe:Drosophila_2:1636086_at:263:697; Interrogation_Position=1465; Antisense; TTTCGTATCCACCAAGCAGGTCTAA
>probe:Drosophila_2:1636086_at:499:355; Interrogation_Position=1494; Antisense; GCACTGGATCCGAAAGAGCTTCTAC
>probe:Drosophila_2:1636086_at:315:641; Interrogation_Position=1563; Antisense; TCTGGAGACTCTTAAGCCCCTGAAT
>probe:Drosophila_2:1636086_at:724:519; Interrogation_Position=1619; Antisense; GTGGAGCAGCCATCGCAGTAGCGTC
>probe:Drosophila_2:1636086_at:96:487; Interrogation_Position=1636; Antisense; GTAGCGTCTGCGATTTTCATAATGG

Paste this into a BLAST search page for me
TTTCCGCCCTACCACGTGAGAATAGGAGGATCTCCTTCGCGGTGACCAGAGATCCTGGGCATGCGAAACGAATTCAACTTTGATGGAGCTTTCCGGGCGCTTTACCTGATTGACGATCCCAACGACAACGAGCTGTACGATCTGCGCAACGATTAAAACCCAGCAGCGACACTTTGGTCTAAGGATCTCTGCTTCTTCGACCGATTCGATTTACTGGGAGTCCATTTTCGTATCCACCAAGCAGGTCTAAGCACTGGATCCGAAAGAGCTTCTACTCTGGAGACTCTTAAGCCCCTGAATGTGGAGCAGCCATCGCAGTAGCGTCGTAGCGTCTGCGATTTTCATAATGG

Full Affymetrix probeset data:

Annotations for 1636086_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime