FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636087_at:

>probe:Drosophila_2:1636087_at:23:637; Interrogation_Position=3161; Antisense; TCGACTTCACGATTTCGAAGGATGT
>probe:Drosophila_2:1636087_at:614:717; Interrogation_Position=3174; Antisense; TTCGAAGGATGTTCGATCCTTGGTC
>probe:Drosophila_2:1636087_at:13:273; Interrogation_Position=3192; Antisense; CTTGGTCTACGATCGCGTAATCGAT
>probe:Drosophila_2:1636087_at:82:499; Interrogation_Position=3196; Antisense; GTCTACGATCGCGTAATCGATTTGT
>probe:Drosophila_2:1636087_at:105:451; Interrogation_Position=3202; Antisense; GATCGCGTAATCGATTTGTGCGGTT
>probe:Drosophila_2:1636087_at:551:327; Interrogation_Position=3206; Antisense; GCGTAATCGATTTGTGCGGTTCAAA
>probe:Drosophila_2:1636087_at:194:469; Interrogation_Position=3224; Antisense; GTTCAAATTGAACTTTTAGCTTACG
>probe:Drosophila_2:1636087_at:173:379; Interrogation_Position=3233; Antisense; GAACTTTTAGCTTACGAATGAAATA
>probe:Drosophila_2:1636087_at:481:241; Interrogation_Position=3272; Antisense; AATAGATTTGCTTGGCACATATGTG
>probe:Drosophila_2:1636087_at:635:95; Interrogation_Position=3275; Antisense; AGATTTGCTTGGCACATATGTGAAA
>probe:Drosophila_2:1636087_at:542:355; Interrogation_Position=3286; Antisense; GCACATATGTGAAATTGCCTTTTCC
>probe:Drosophila_2:1636087_at:380:393; Interrogation_Position=3296; Antisense; GAAATTGCCTTTTCCTAAGGGCTCG
>probe:Drosophila_2:1636087_at:2:627; Interrogation_Position=3301; Antisense; TGCCTTTTCCTAAGGGCTCGGAAAT
>probe:Drosophila_2:1636087_at:368:277; Interrogation_Position=3310; Antisense; CTAAGGGCTCGGAAATAAATATAAT

Paste this into a BLAST search page for me
TCGACTTCACGATTTCGAAGGATGTTTCGAAGGATGTTCGATCCTTGGTCCTTGGTCTACGATCGCGTAATCGATGTCTACGATCGCGTAATCGATTTGTGATCGCGTAATCGATTTGTGCGGTTGCGTAATCGATTTGTGCGGTTCAAAGTTCAAATTGAACTTTTAGCTTACGGAACTTTTAGCTTACGAATGAAATAAATAGATTTGCTTGGCACATATGTGAGATTTGCTTGGCACATATGTGAAAGCACATATGTGAAATTGCCTTTTCCGAAATTGCCTTTTCCTAAGGGCTCGTGCCTTTTCCTAAGGGCTCGGAAATCTAAGGGCTCGGAAATAAATATAAT

Full Affymetrix probeset data:

Annotations for 1636087_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720