FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636088_at:

>probe:Drosophila_2:1636088_at:445:423; Interrogation_Position=2065; Antisense; GAGAACATTCCTCAATCACAGAAGC
>probe:Drosophila_2:1636088_at:594:423; Interrogation_Position=2095; Antisense; GAGAGTATGAAACGTGTCCTTTAAT
>probe:Drosophila_2:1636088_at:401:35; Interrogation_Position=2247; Antisense; ATCAGCTGTTGATCTTAGAGTTTCT
>probe:Drosophila_2:1636088_at:713:417; Interrogation_Position=2264; Antisense; GAGTTTCTTTCGAGTGATTTGTTCT
>probe:Drosophila_2:1636088_at:45:87; Interrogation_Position=2366; Antisense; AGTCCTCCTAATTCATAAATGCCCT
>probe:Drosophila_2:1636088_at:329:703; Interrogation_Position=2407; Antisense; TTATTTTACCTGCACCCAAAAGAGG
>probe:Drosophila_2:1636088_at:727:557; Interrogation_Position=2417; Antisense; TGCACCCAAAAGAGGAGACCGGTTT
>probe:Drosophila_2:1636088_at:361:413; Interrogation_Position=2433; Antisense; GACCGGTTTCGTTCTTTATTGTGCA
>probe:Drosophila_2:1636088_at:404:31; Interrogation_Position=2460; Antisense; ATAATCTTATTTACCAACCTGTTGG
>probe:Drosophila_2:1636088_at:680:303; Interrogation_Position=2477; Antisense; CCTGTTGGGCGTTAACTAATTGCTT
>probe:Drosophila_2:1636088_at:150:491; Interrogation_Position=2507; Antisense; GTACATTTTGTATAGACCGCATGCA
>probe:Drosophila_2:1636088_at:74:413; Interrogation_Position=2521; Antisense; GACCGCATGCAGAATCAAATGTGTG
>probe:Drosophila_2:1636088_at:548:509; Interrogation_Position=2543; Antisense; GTGCATCAAATGTCAAGGGATCCCA
>probe:Drosophila_2:1636088_at:328:79; Interrogation_Position=2558; Antisense; AGGGATCCCATTTTAACAATCGAAT

Paste this into a BLAST search page for me
GAGAACATTCCTCAATCACAGAAGCGAGAGTATGAAACGTGTCCTTTAATATCAGCTGTTGATCTTAGAGTTTCTGAGTTTCTTTCGAGTGATTTGTTCTAGTCCTCCTAATTCATAAATGCCCTTTATTTTACCTGCACCCAAAAGAGGTGCACCCAAAAGAGGAGACCGGTTTGACCGGTTTCGTTCTTTATTGTGCAATAATCTTATTTACCAACCTGTTGGCCTGTTGGGCGTTAACTAATTGCTTGTACATTTTGTATAGACCGCATGCAGACCGCATGCAGAATCAAATGTGTGGTGCATCAAATGTCAAGGGATCCCAAGGGATCCCATTTTAACAATCGAAT

Full Affymetrix probeset data:

Annotations for 1636088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720