FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636089_at:

>probe:Drosophila_2:1636089_at:210:79; Interrogation_Position=1097; Antisense; AGGATAAAGCCGACTCCTCATCGTC
>probe:Drosophila_2:1636089_at:594:367; Interrogation_Position=1153; Antisense; GAATCCAGCAACTTGGCCACAGCAA
>probe:Drosophila_2:1636089_at:202:201; Interrogation_Position=1176; Antisense; AACGCCTGCCATTTGCATTAACATG
>probe:Drosophila_2:1636089_at:244:455; Interrogation_Position=1228; Antisense; GATAATTCAGATTCCGATTCCGCAA
>probe:Drosophila_2:1636089_at:399:675; Interrogation_Position=1271; Antisense; TAGCACAAAGTTTACAGCCGGCGGC
>probe:Drosophila_2:1636089_at:525:625; Interrogation_Position=1299; Antisense; TGCCGACGATGATTGCGCCTCATTG
>probe:Drosophila_2:1636089_at:4:323; Interrogation_Position=1313; Antisense; GCGCCTCATTGGTCGTTGTTGTTGC
>probe:Drosophila_2:1636089_at:259:677; Interrogation_Position=1395; Antisense; TAGGGCCGGGAGTAGCAGCCCAATT
>probe:Drosophila_2:1636089_at:114:353; Interrogation_Position=1409; Antisense; GCAGCCCAATTGCTTAGTCACTTGT
>probe:Drosophila_2:1636089_at:187:679; Interrogation_Position=1437; Antisense; TAGTTGCATCGTCTGCTAATGTTGT
>probe:Drosophila_2:1636089_at:628:339; Interrogation_Position=1451; Antisense; GCTAATGTTGTTTGCCCCATGTAAT
>probe:Drosophila_2:1636089_at:133:23; Interrogation_Position=1481; Antisense; ATATCTCCGAGAATGTACCCTCTCC
>probe:Drosophila_2:1636089_at:307:363; Interrogation_Position=1604; Antisense; GAATTGTCTATCGATTAAGCCCTAA
>probe:Drosophila_2:1636089_at:200:707; Interrogation_Position=1618; Antisense; TTAAGCCCTAATATCTAAGCGAGAG

Paste this into a BLAST search page for me
AGGATAAAGCCGACTCCTCATCGTCGAATCCAGCAACTTGGCCACAGCAAAACGCCTGCCATTTGCATTAACATGGATAATTCAGATTCCGATTCCGCAATAGCACAAAGTTTACAGCCGGCGGCTGCCGACGATGATTGCGCCTCATTGGCGCCTCATTGGTCGTTGTTGTTGCTAGGGCCGGGAGTAGCAGCCCAATTGCAGCCCAATTGCTTAGTCACTTGTTAGTTGCATCGTCTGCTAATGTTGTGCTAATGTTGTTTGCCCCATGTAATATATCTCCGAGAATGTACCCTCTCCGAATTGTCTATCGATTAAGCCCTAATTAAGCCCTAATATCTAAGCGAGAG

Full Affymetrix probeset data:

Annotations for 1636089_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720