FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636091_at:

>probe:Drosophila_2:1636091_at:617:511; Interrogation_Position=2978; Antisense; GTGACCTCTTCGAGCGGACGACCAG
>probe:Drosophila_2:1636091_at:579:85; Interrogation_Position=3009; Antisense; AGTGCGGGATGTTTTACCTTCTCTG
>probe:Drosophila_2:1636091_at:587:711; Interrogation_Position=3027; Antisense; TTCTCTGCCGGACAAGTCCGTGAAA
>probe:Drosophila_2:1636091_at:460:613; Interrogation_Position=3047; Antisense; TGAAAATCCTGGTGGAGCGCATCGA
>probe:Drosophila_2:1636091_at:697:505; Interrogation_Position=3096; Antisense; GTGCCAGGGCAGCTAATGAATCGAT
>probe:Drosophila_2:1636091_at:209:1; Interrogation_Position=3145; Antisense; ACGACTGATAAGCTGTTAATACCGA
>probe:Drosophila_2:1636091_at:547:295; Interrogation_Position=3167; Antisense; CGAAACAGCAGTGGGTGGATCTTCA
>probe:Drosophila_2:1636091_at:41:645; Interrogation_Position=3186; Antisense; TCTTCACCTAGATTGGGATTGCAGT
>probe:Drosophila_2:1636091_at:153:489; Interrogation_Position=3220; Antisense; GTCAGCGGCTTTGTCGAGGTTATAT
>probe:Drosophila_2:1636091_at:114:117; Interrogation_Position=3323; Antisense; AGCATATTCGATAAGCCACTGACCC
>probe:Drosophila_2:1636091_at:388:143; Interrogation_Position=3340; Antisense; ACTGACCCAAGGAGATCCGAGTATT
>probe:Drosophila_2:1636091_at:114:533; Interrogation_Position=3368; Antisense; GGGTGATCCACTAGAATACCTATCT
>probe:Drosophila_2:1636091_at:97:601; Interrogation_Position=3393; Antisense; TGTAAATGCCAGACTCTATCCATGA
>probe:Drosophila_2:1636091_at:608:659; Interrogation_Position=3457; Antisense; TAAGCCTAGCTAGCGTTAACAATGT

Paste this into a BLAST search page for me
GTGACCTCTTCGAGCGGACGACCAGAGTGCGGGATGTTTTACCTTCTCTGTTCTCTGCCGGACAAGTCCGTGAAATGAAAATCCTGGTGGAGCGCATCGAGTGCCAGGGCAGCTAATGAATCGATACGACTGATAAGCTGTTAATACCGACGAAACAGCAGTGGGTGGATCTTCATCTTCACCTAGATTGGGATTGCAGTGTCAGCGGCTTTGTCGAGGTTATATAGCATATTCGATAAGCCACTGACCCACTGACCCAAGGAGATCCGAGTATTGGGTGATCCACTAGAATACCTATCTTGTAAATGCCAGACTCTATCCATGATAAGCCTAGCTAGCGTTAACAATGT

Full Affymetrix probeset data:

Annotations for 1636091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720