FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636094_at:

>probe:Drosophila_2:1636094_at:19:513; Interrogation_Position=2829; Antisense; GGACGAACTTAATCTTAACCGGATG
>probe:Drosophila_2:1636094_at:247:443; Interrogation_Position=2853; Antisense; GATGACTATTTTGATGTCCCGCAAG
>probe:Drosophila_2:1636094_at:469:503; Interrogation_Position=2868; Antisense; GTCCCGCAAGCAAATGGATCCCGAG
>probe:Drosophila_2:1636094_at:447:257; Interrogation_Position=2912; Antisense; CACTGGAGAAGGAGCGTCACGCCTA
>probe:Drosophila_2:1636094_at:3:439; Interrogation_Position=2938; Antisense; GAGGCTGCCAAGAAAAAGTCCCATT
>probe:Drosophila_2:1636094_at:391:691; Interrogation_Position=2961; Antisense; TTTGGATATCCTGGCCACAGTGGAA
>probe:Drosophila_2:1636094_at:186:249; Interrogation_Position=3002; Antisense; TAAGGTCCAGAATCCTGCCGTTAGA
>probe:Drosophila_2:1636094_at:390:317; Interrogation_Position=3018; Antisense; GCCGTTAGAGCTTCAGGACATGCAG
>probe:Drosophila_2:1636094_at:151:101; Interrogation_Position=3075; Antisense; AGAGGTTGAGAACGCGGACTCCTAT
>probe:Drosophila_2:1636094_at:434:435; Interrogation_Position=3192; Antisense; GAGGCGTCAACTTTTGGATCAATCC
>probe:Drosophila_2:1636094_at:530:163; Interrogation_Position=3225; Antisense; AAATACGGATCGACTGCGGTGGTAC
>probe:Drosophila_2:1636094_at:43:525; Interrogation_Position=3276; Antisense; GGGCGAGTGCCAGTTCATCTACGAA
>probe:Drosophila_2:1636094_at:196:437; Interrogation_Position=3322; Antisense; GAGGAGTCCAGCCATCCCGAATTTG
>probe:Drosophila_2:1636094_at:216:303; Interrogation_Position=3338; Antisense; CCGAATTTGCGGCACCTCAGAAAAT

Paste this into a BLAST search page for me
GGACGAACTTAATCTTAACCGGATGGATGACTATTTTGATGTCCCGCAAGGTCCCGCAAGCAAATGGATCCCGAGCACTGGAGAAGGAGCGTCACGCCTAGAGGCTGCCAAGAAAAAGTCCCATTTTTGGATATCCTGGCCACAGTGGAATAAGGTCCAGAATCCTGCCGTTAGAGCCGTTAGAGCTTCAGGACATGCAGAGAGGTTGAGAACGCGGACTCCTATGAGGCGTCAACTTTTGGATCAATCCAAATACGGATCGACTGCGGTGGTACGGGCGAGTGCCAGTTCATCTACGAAGAGGAGTCCAGCCATCCCGAATTTGCCGAATTTGCGGCACCTCAGAAAAT

Full Affymetrix probeset data:

Annotations for 1636094_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720