Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636096_at:

>probe:Drosophila_2:1636096_at:34:599; Interrogation_Position=2001; Antisense; TGTCCATGGACAGCCTACATCTCAA
>probe:Drosophila_2:1636096_at:723:329; Interrogation_Position=2027; Antisense; GCGGGCATCGCAAATACCAGTGGCA
>probe:Drosophila_2:1636096_at:513:267; Interrogation_Position=2044; Antisense; CAGTGGCAGCAATAGTCCGGCAACT
>probe:Drosophila_2:1636096_at:442:359; Interrogation_Position=2075; Antisense; GCAACGTCTATGTCACCATCATTTG
>probe:Drosophila_2:1636096_at:377:605; Interrogation_Position=2116; Antisense; TGATATTGTGCCTTTTCACCTCCAT
>probe:Drosophila_2:1636096_at:331:51; Interrogation_Position=2145; Antisense; ATGCGGCGGCATTCAAACTCAACGA
>probe:Drosophila_2:1636096_at:354:357; Interrogation_Position=2179; Antisense; GCACATGATCTAACCACGCAATTTG
>probe:Drosophila_2:1636096_at:51:101; Interrogation_Position=2241; Antisense; AGAGGGATTTCCAAGCAGTAGCTGC
>probe:Drosophila_2:1636096_at:251:91; Interrogation_Position=2257; Antisense; AGTAGCTGCTTTCTTTCATTTCGGG
>probe:Drosophila_2:1636096_at:181:573; Interrogation_Position=2291; Antisense; GGCTCGTGTGGGATCTTTAGTCATA
>probe:Drosophila_2:1636096_at:544:425; Interrogation_Position=2367; Antisense; GAGATGCCACAGTTTTATCCTTGGT
>probe:Drosophila_2:1636096_at:5:183; Interrogation_Position=2395; Antisense; AAAACTCTTGCCGTTCAATCATTAT
>probe:Drosophila_2:1636096_at:431:711; Interrogation_Position=2502; Antisense; TTCAATTATGTTTCTTGTCGCCCCA
>probe:Drosophila_2:1636096_at:146:725; Interrogation_Position=2516; Antisense; TTGTCGCCCCAGTACTTTAAGGAAT

Paste this into a BLAST search page for me
TGTCCATGGACAGCCTACATCTCAAGCGGGCATCGCAAATACCAGTGGCACAGTGGCAGCAATAGTCCGGCAACTGCAACGTCTATGTCACCATCATTTGTGATATTGTGCCTTTTCACCTCCATATGCGGCGGCATTCAAACTCAACGAGCACATGATCTAACCACGCAATTTGAGAGGGATTTCCAAGCAGTAGCTGCAGTAGCTGCTTTCTTTCATTTCGGGGGCTCGTGTGGGATCTTTAGTCATAGAGATGCCACAGTTTTATCCTTGGTAAAACTCTTGCCGTTCAATCATTATTTCAATTATGTTTCTTGTCGCCCCATTGTCGCCCCAGTACTTTAAGGAAT

Full Affymetrix probeset data:

Annotations for 1636096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime