FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636097_at:

>probe:Drosophila_2:1636097_at:399:707; Interrogation_Position=401; Antisense; TTCATTCGCACTCCCGAAAATCAGG
>probe:Drosophila_2:1636097_at:459:387; Interrogation_Position=416; Antisense; GAAAATCAGGGCTTCGAGCGCGCTG
>probe:Drosophila_2:1636097_at:283:95; Interrogation_Position=447; Antisense; AGTTGGCCAAGCAGTCTGCTCAGCA
>probe:Drosophila_2:1636097_at:533:59; Interrogation_Position=486; Antisense; ATGTTCTCACCAAACAGTCCGATGT
>probe:Drosophila_2:1636097_at:612:293; Interrogation_Position=505; Antisense; CGATGTGTCCAACCTGGCTAAGCAA
>probe:Drosophila_2:1636097_at:460:233; Interrogation_Position=533; Antisense; AATGCCCTGAAGACGAGCTCCACCA
>probe:Drosophila_2:1636097_at:411:77; Interrogation_Position=597; Antisense; AGGATGCGGCTAATGCCCAACTGGC
>probe:Drosophila_2:1636097_at:155:107; Interrogation_Position=627; Antisense; AGAACCAGTACAACCAATTGCCCGG
>probe:Drosophila_2:1636097_at:635:515; Interrogation_Position=653; Antisense; GTGTCTCGCATCTCCAACGAGGGTC
>probe:Drosophila_2:1636097_at:602:197; Interrogation_Position=668; Antisense; AACGAGGGTCGTGCTCCTGTCCTGA
>probe:Drosophila_2:1636097_at:594:493; Interrogation_Position=813; Antisense; GTCGTTTCCGCGTCAAGTAAATGGT
>probe:Drosophila_2:1636097_at:134:721; Interrogation_Position=864; Antisense; TTCCTATCCCAGAATATCGCATCGA
>probe:Drosophila_2:1636097_at:375:171; Interrogation_Position=891; Antisense; AAAGAAAACACCTAGCTACTCCCAT
>probe:Drosophila_2:1636097_at:515:145; Interrogation_Position=908; Antisense; ACTCCCATCACGTGCAAGTTAACTA

Paste this into a BLAST search page for me
TTCATTCGCACTCCCGAAAATCAGGGAAAATCAGGGCTTCGAGCGCGCTGAGTTGGCCAAGCAGTCTGCTCAGCAATGTTCTCACCAAACAGTCCGATGTCGATGTGTCCAACCTGGCTAAGCAAAATGCCCTGAAGACGAGCTCCACCAAGGATGCGGCTAATGCCCAACTGGCAGAACCAGTACAACCAATTGCCCGGGTGTCTCGCATCTCCAACGAGGGTCAACGAGGGTCGTGCTCCTGTCCTGAGTCGTTTCCGCGTCAAGTAAATGGTTTCCTATCCCAGAATATCGCATCGAAAAGAAAACACCTAGCTACTCCCATACTCCCATCACGTGCAAGTTAACTA

Full Affymetrix probeset data:

Annotations for 1636097_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720