FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636098_at:

>probe:Drosophila_2:1636098_at:713:33; Interrogation_Position=1008; Antisense; ATCAAGCTGCCCAATCTAATGTGTG
>probe:Drosophila_2:1636098_at:149:281; Interrogation_Position=1023; Antisense; CTAATGTGTGATCCCGACGAGATGA
>probe:Drosophila_2:1636098_at:269:333; Interrogation_Position=1052; Antisense; GCTGGCCGACAAGTATCGTCTACAA
>probe:Drosophila_2:1636098_at:395:33; Interrogation_Position=1077; Antisense; ATCAGAGGAACCTCGGGCGAGCACT
>probe:Drosophila_2:1636098_at:352:433; Interrogation_Position=1117; Antisense; GAGTGCACGATATATCCAACCAACG
>probe:Drosophila_2:1636098_at:208:529; Interrogation_Position=1260; Antisense; GGTTAAAGGCCGTGATGAACTCTAA
>probe:Drosophila_2:1636098_at:596:75; Interrogation_Position=721; Antisense; AGGAGGGCGATCGATTTCTGGCTTC
>probe:Drosophila_2:1636098_at:195:415; Interrogation_Position=751; Antisense; GAGCCTCTCGATATTGGCCAACGGG
>probe:Drosophila_2:1636098_at:445:525; Interrogation_Position=779; Antisense; GGGCATCTTTCTGAATAGCGCCAAG
>probe:Drosophila_2:1636098_at:194:437; Interrogation_Position=825; Antisense; GAGGAGGACCACATACGCATCATCT
>probe:Drosophila_2:1636098_at:123:287; Interrogation_Position=870; Antisense; CTGGGCAAGGTCTACGATCGCATGG
>probe:Drosophila_2:1636098_at:700:437; Interrogation_Position=906; Antisense; GAGGCTCTCGGCAAGCAGCTGCAAT
>probe:Drosophila_2:1636098_at:708:443; Interrogation_Position=939; Antisense; GATGAACGACTTGGCTTTTTAACCT
>probe:Drosophila_2:1636098_at:457:127; Interrogation_Position=972; Antisense; ACCAATCTGGGCACTTCTATTCGCG

Paste this into a BLAST search page for me
ATCAAGCTGCCCAATCTAATGTGTGCTAATGTGTGATCCCGACGAGATGAGCTGGCCGACAAGTATCGTCTACAAATCAGAGGAACCTCGGGCGAGCACTGAGTGCACGATATATCCAACCAACGGGTTAAAGGCCGTGATGAACTCTAAAGGAGGGCGATCGATTTCTGGCTTCGAGCCTCTCGATATTGGCCAACGGGGGGCATCTTTCTGAATAGCGCCAAGGAGGAGGACCACATACGCATCATCTCTGGGCAAGGTCTACGATCGCATGGGAGGCTCTCGGCAAGCAGCTGCAATGATGAACGACTTGGCTTTTTAACCTACCAATCTGGGCACTTCTATTCGCG

Full Affymetrix probeset data:

Annotations for 1636098_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720