FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636100_at:

>probe:Drosophila_2:1636100_at:525:199; Interrogation_Position=106; Antisense; AACGCAACTTCAGCTGGTGTCGCCG
>probe:Drosophila_2:1636100_at:211:517; Interrogation_Position=122; Antisense; GTGTCGCCGCCACTTTCATCGACAA
>probe:Drosophila_2:1636100_at:47:149; Interrogation_Position=133; Antisense; ACTTTCATCGACAACACCAGCAGCA
>probe:Drosophila_2:1636100_at:284:361; Interrogation_Position=155; Antisense; GCAATGCCAGCAGAAATGACCACAT
>probe:Drosophila_2:1636100_at:159:609; Interrogation_Position=171; Antisense; TGACCACATGGTCCAAAACAATGAA
>probe:Drosophila_2:1636100_at:678:183; Interrogation_Position=187; Antisense; AACAATGAAAATCCCGCCTCCTTTG
>probe:Drosophila_2:1636100_at:351:315; Interrogation_Position=202; Antisense; GCCTCCTTTGAGCAGCAGACACTGC
>probe:Drosophila_2:1636100_at:17:359; Interrogation_Position=243; Antisense; GCAACAAGCTACTGTGCAATATGCA
>probe:Drosophila_2:1636100_at:424:243; Interrogation_Position=260; Antisense; AATATGCACATATATCGCCATTAGA
>probe:Drosophila_2:1636100_at:346:359; Interrogation_Position=27; Antisense; GCAACAGCAACTGCCAGCTGGTGTT
>probe:Drosophila_2:1636100_at:516:483; Interrogation_Position=292; Antisense; GTAGGTATGCATCAACCGAAACAAC
>probe:Drosophila_2:1636100_at:178:121; Interrogation_Position=42; Antisense; AGCTGGTGTTGCAGCGACGACAGCA
>probe:Drosophila_2:1636100_at:518:263; Interrogation_Position=84; Antisense; CAGCAGCAACATGAGACTCTTGAAC
>probe:Drosophila_2:1636100_at:568:403; Interrogation_Position=98; Antisense; GACTCTTGAACGCAACTTCAGCTGG

Paste this into a BLAST search page for me
AACGCAACTTCAGCTGGTGTCGCCGGTGTCGCCGCCACTTTCATCGACAAACTTTCATCGACAACACCAGCAGCAGCAATGCCAGCAGAAATGACCACATTGACCACATGGTCCAAAACAATGAAAACAATGAAAATCCCGCCTCCTTTGGCCTCCTTTGAGCAGCAGACACTGCGCAACAAGCTACTGTGCAATATGCAAATATGCACATATATCGCCATTAGAGCAACAGCAACTGCCAGCTGGTGTTGTAGGTATGCATCAACCGAAACAACAGCTGGTGTTGCAGCGACGACAGCACAGCAGCAACATGAGACTCTTGAACGACTCTTGAACGCAACTTCAGCTGG

Full Affymetrix probeset data:

Annotations for 1636100_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720