Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636102_at:

>probe:Drosophila_2:1636102_at:598:597; Interrogation_Position=3075; Antisense; TGTCAGGCGATGTCATTAGCTCAAT
>probe:Drosophila_2:1636102_at:382:61; Interrogation_Position=3084; Antisense; ATGTCATTAGCTCAATGGCCGCCAG
>probe:Drosophila_2:1636102_at:125:309; Interrogation_Position=3105; Antisense; CCAGTCCCACAGACGCTTGTAGCAT
>probe:Drosophila_2:1636102_at:133:105; Interrogation_Position=3115; Antisense; AGACGCTTGTAGCATCCGTTCTAAT
>probe:Drosophila_2:1636102_at:576:595; Interrogation_Position=3122; Antisense; TGTAGCATCCGTTCTAATCCGTCGG
>probe:Drosophila_2:1636102_at:614:647; Interrogation_Position=3136; Antisense; TAATCCGTCGGCTGCCTCACTTCTT
>probe:Drosophila_2:1636102_at:222:693; Interrogation_Position=3162; Antisense; TTTCCACGTCGGCAGCTGCAGCAGA
>probe:Drosophila_2:1636102_at:15:353; Interrogation_Position=3179; Antisense; GCAGCAGAGGCTTCTGCATTGGCCT
>probe:Drosophila_2:1636102_at:153:641; Interrogation_Position=3191; Antisense; TCTGCATTGGCCTCGGCAACTACTA
>probe:Drosophila_2:1636102_at:146:567; Interrogation_Position=3205; Antisense; GGCAACTACTATGTCCGTTTCGGGA
>probe:Drosophila_2:1636102_at:118:499; Interrogation_Position=3217; Antisense; GTCCGTTTCGGGAGCAACACTATCA
>probe:Drosophila_2:1636102_at:660:551; Interrogation_Position=3227; Antisense; GGAGCAACACTATCACCTCTAGCCA
>probe:Drosophila_2:1636102_at:134:635; Interrogation_Position=3265; Antisense; TCGCCGCCCTAGCATCACAATGATG
>probe:Drosophila_2:1636102_at:261:649; Interrogation_Position=3279; Antisense; TCACAATGATGAATCCCAGCTCCGG

Paste this into a BLAST search page for me
TGTCAGGCGATGTCATTAGCTCAATATGTCATTAGCTCAATGGCCGCCAGCCAGTCCCACAGACGCTTGTAGCATAGACGCTTGTAGCATCCGTTCTAATTGTAGCATCCGTTCTAATCCGTCGGTAATCCGTCGGCTGCCTCACTTCTTTTTCCACGTCGGCAGCTGCAGCAGAGCAGCAGAGGCTTCTGCATTGGCCTTCTGCATTGGCCTCGGCAACTACTAGGCAACTACTATGTCCGTTTCGGGAGTCCGTTTCGGGAGCAACACTATCAGGAGCAACACTATCACCTCTAGCCATCGCCGCCCTAGCATCACAATGATGTCACAATGATGAATCCCAGCTCCGG

Full Affymetrix probeset data:

Annotations for 1636102_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime