Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636105_at:

>probe:Drosophila_2:1636105_at:184:191; Interrogation_Position=272; Antisense; AACTCTACCAGAACAACGACGAACT
>probe:Drosophila_2:1636105_at:74:409; Interrogation_Position=289; Antisense; GACGAACTGTATCGCATCCCAGAGC
>probe:Drosophila_2:1636105_at:345:155; Interrogation_Position=377; Antisense; ACAGCAACACGGCAATCGGCGGAAT
>probe:Drosophila_2:1636105_at:49:289; Interrogation_Position=386; Antisense; CGGCAATCGGCGGAATCAACAGCAG
>probe:Drosophila_2:1636105_at:385:487; Interrogation_Position=467; Antisense; GTAGCATGAGATTTACCACACCAAG
>probe:Drosophila_2:1636105_at:473:459; Interrogation_Position=476; Antisense; GATTTACCACACCAAGTACCAATCC
>probe:Drosophila_2:1636105_at:583:235; Interrogation_Position=496; Antisense; AATCCCCAATCGTCATACTCATCAT
>probe:Drosophila_2:1636105_at:393:201; Interrogation_Position=607; Antisense; AAGCCTAGTAGCGTTAACCATAGAG
>probe:Drosophila_2:1636105_at:194:529; Interrogation_Position=635; Antisense; GGGATAGCAACCAAACTAGATCTAG
>probe:Drosophila_2:1636105_at:25:679; Interrogation_Position=651; Antisense; TAGATCTAGGAACCGCACTCACAAT
>probe:Drosophila_2:1636105_at:369:161; Interrogation_Position=671; Antisense; ACAATACCCCTCAATCCGGCAAGAA
>probe:Drosophila_2:1636105_at:263:159; Interrogation_Position=707; Antisense; ACAACAACAGCTCGCGAGGCAAACA
>probe:Drosophila_2:1636105_at:617:587; Interrogation_Position=747; Antisense; TAAGTTCGAAAATGATGCGGAGCTC
>probe:Drosophila_2:1636105_at:579:445; Interrogation_Position=760; Antisense; GATGCGGAGCTCAAGGATTACAAGA

Paste this into a BLAST search page for me
AACTCTACCAGAACAACGACGAACTGACGAACTGTATCGCATCCCAGAGCACAGCAACACGGCAATCGGCGGAATCGGCAATCGGCGGAATCAACAGCAGGTAGCATGAGATTTACCACACCAAGGATTTACCACACCAAGTACCAATCCAATCCCCAATCGTCATACTCATCATAAGCCTAGTAGCGTTAACCATAGAGGGGATAGCAACCAAACTAGATCTAGTAGATCTAGGAACCGCACTCACAATACAATACCCCTCAATCCGGCAAGAAACAACAACAGCTCGCGAGGCAAACATAAGTTCGAAAATGATGCGGAGCTCGATGCGGAGCTCAAGGATTACAAGA

Full Affymetrix probeset data:

Annotations for 1636105_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime