Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636107_at:

>probe:Drosophila_2:1636107_at:157:165; Interrogation_Position=1224; Antisense; AAATACGCCCATTTGGAGCTGGCTC
>probe:Drosophila_2:1636107_at:382:351; Interrogation_Position=1258; Antisense; GCAGCTTGGCCGAGCAGCCCTAAAA
>probe:Drosophila_2:1636107_at:215:113; Interrogation_Position=1270; Antisense; AGCAGCCCTAAAAGCTGGCCAGGAT
>probe:Drosophila_2:1636107_at:617:451; Interrogation_Position=1292; Antisense; GATCGGCAGAGGAACACAGACACAT
>probe:Drosophila_2:1636107_at:486:389; Interrogation_Position=1389; Antisense; GAAACCAGTCCGAAACCAGAAGGAT
>probe:Drosophila_2:1636107_at:308:355; Interrogation_Position=1407; Antisense; GAAGGATTCTTGAGGACTTGCAAAT
>probe:Drosophila_2:1636107_at:642:525; Interrogation_Position=1436; Antisense; GGGCAGCAGGCACTCTAGGATTAAA
>probe:Drosophila_2:1636107_at:662:231; Interrogation_Position=1540; Antisense; AATGCATGCATTATATTCGTACGAT
>probe:Drosophila_2:1636107_at:380:489; Interrogation_Position=1558; Antisense; GTACGATATGTATACACACACGACA
>probe:Drosophila_2:1636107_at:197:49; Interrogation_Position=1638; Antisense; ATGCACTAGCATAGTCATTGCCACA
>probe:Drosophila_2:1636107_at:413:497; Interrogation_Position=1651; Antisense; GTCATTGCCACACATATAGAGCCCC
>probe:Drosophila_2:1636107_at:511:225; Interrogation_Position=1714; Antisense; AAGGAAGCTTACAGCGCCAGGGTGC
>probe:Drosophila_2:1636107_at:633:311; Interrogation_Position=1729; Antisense; GCCAGGGTGCCTCACTGTAAATAAA
>probe:Drosophila_2:1636107_at:598:549; Interrogation_Position=1789; Antisense; TGGAGGTACACCTCCCAAGCTTAAC

Paste this into a BLAST search page for me
AAATACGCCCATTTGGAGCTGGCTCGCAGCTTGGCCGAGCAGCCCTAAAAAGCAGCCCTAAAAGCTGGCCAGGATGATCGGCAGAGGAACACAGACACATGAAACCAGTCCGAAACCAGAAGGATGAAGGATTCTTGAGGACTTGCAAATGGGCAGCAGGCACTCTAGGATTAAAAATGCATGCATTATATTCGTACGATGTACGATATGTATACACACACGACAATGCACTAGCATAGTCATTGCCACAGTCATTGCCACACATATAGAGCCCCAAGGAAGCTTACAGCGCCAGGGTGCGCCAGGGTGCCTCACTGTAAATAAATGGAGGTACACCTCCCAAGCTTAAC

Full Affymetrix probeset data:

Annotations for 1636107_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime