Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636108_at:

>probe:Drosophila_2:1636108_at:685:515; Interrogation_Position=1040; Antisense; GTGTCGACGCATTCCAGGCAAGCAA
>probe:Drosophila_2:1636108_at:622:565; Interrogation_Position=1056; Antisense; GGCAAGCAAGCTGTGCTCGTTTTGA
>probe:Drosophila_2:1636108_at:295:437; Interrogation_Position=1104; Antisense; GAGGACGTCATGATCGATCCAGGTT
>probe:Drosophila_2:1636108_at:650:47; Interrogation_Position=1120; Antisense; ATCCAGGTTTGGTCATGATCTTCGC
>probe:Drosophila_2:1636108_at:678:605; Interrogation_Position=1135; Antisense; TGATCTTCGCCCATGGCATCGAGTA
>probe:Drosophila_2:1636108_at:260:125; Interrogation_Position=1167; Antisense; AGCCGCTGATTAACCACTTATCCTA
>probe:Drosophila_2:1636108_at:221:155; Interrogation_Position=1214; Antisense; ACAGTGCTCAGTTTTGTTGATTCCT
>probe:Drosophila_2:1636108_at:658:181; Interrogation_Position=1286; Antisense; AAAACAAACCATTCAAGCGCCTCAT
>probe:Drosophila_2:1636108_at:188:125; Interrogation_Position=1301; Antisense; AGCGCCTCATGACGACTTTCAAGTT
>probe:Drosophila_2:1636108_at:448:483; Interrogation_Position=1390; Antisense; GTATACATCATCAAGTCGTTCGCAT
>probe:Drosophila_2:1636108_at:76:251; Interrogation_Position=1401; Antisense; CAAGTCGTTCGCATATACCCAATAT
>probe:Drosophila_2:1636108_at:267:165; Interrogation_Position=1452; Antisense; AAATGTCCCTTTGTTATCGTTCACT
>probe:Drosophila_2:1636108_at:193:477; Interrogation_Position=1464; Antisense; GTTATCGTTCACTTCATTCTCATTT
>probe:Drosophila_2:1636108_at:606:333; Interrogation_Position=1501; Antisense; GCTGTGAATGTCCTAATTCGCGTTT

Paste this into a BLAST search page for me
GTGTCGACGCATTCCAGGCAAGCAAGGCAAGCAAGCTGTGCTCGTTTTGAGAGGACGTCATGATCGATCCAGGTTATCCAGGTTTGGTCATGATCTTCGCTGATCTTCGCCCATGGCATCGAGTAAGCCGCTGATTAACCACTTATCCTAACAGTGCTCAGTTTTGTTGATTCCTAAAACAAACCATTCAAGCGCCTCATAGCGCCTCATGACGACTTTCAAGTTGTATACATCATCAAGTCGTTCGCATCAAGTCGTTCGCATATACCCAATATAAATGTCCCTTTGTTATCGTTCACTGTTATCGTTCACTTCATTCTCATTTGCTGTGAATGTCCTAATTCGCGTTT

Full Affymetrix probeset data:

Annotations for 1636108_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime