FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636109_at:

>probe:Drosophila_2:1636109_at:179:145; Interrogation_Position=105; Antisense; ACTCGTCTACGTCCTGGTCAAGATG
>probe:Drosophila_2:1636109_at:710:667; Interrogation_Position=112; Antisense; TACGTCCTGGTCAAGATGCACCGCC
>probe:Drosophila_2:1636109_at:270:445; Interrogation_Position=126; Antisense; GATGCACCGCCGCAACACGAAGCGG
>probe:Drosophila_2:1636109_at:104:63; Interrogation_Position=13; Antisense; ATGTCCGATCATTTCAACTTCAACG
>probe:Drosophila_2:1636109_at:319:379; Interrogation_Position=144; Antisense; GAAGCGGCGCGAGACCAAGCTCTAC
>probe:Drosophila_2:1636109_at:491:425; Interrogation_Position=154; Antisense; GAGACCAAGCTCTACTGCAAGGGCT
>probe:Drosophila_2:1636109_at:696:143; Interrogation_Position=167; Antisense; ACTGCAAGGGCTGCCAGCAGGCCAT
>probe:Drosophila_2:1636109_at:11:313; Interrogation_Position=179; Antisense; GCCAGCAGGCCATGCTCCATGGCTA
>probe:Drosophila_2:1636109_at:154:711; Interrogation_Position=31; Antisense; TTCAACGAAGCCTTCAACAGCCAGA
>probe:Drosophila_2:1636109_at:123:277; Interrogation_Position=42; Antisense; CTTCAACAGCCAGACCATGCGTGGT
>probe:Drosophila_2:1636109_at:641:413; Interrogation_Position=54; Antisense; GACCATGCGTGGTCGCGCCAATGTA
>probe:Drosophila_2:1636109_at:411:519; Interrogation_Position=62; Antisense; GTGGTCGCGCCAATGTAGCCAAGGC
>probe:Drosophila_2:1636109_at:219:309; Interrogation_Position=70; Antisense; GCCAATGTAGCCAAGGCCACCTGGG
>probe:Drosophila_2:1636109_at:586:285; Interrogation_Position=90; Antisense; CTGGGCCTCGTTGGGACTCGTCTAC

Paste this into a BLAST search page for me
ACTCGTCTACGTCCTGGTCAAGATGTACGTCCTGGTCAAGATGCACCGCCGATGCACCGCCGCAACACGAAGCGGATGTCCGATCATTTCAACTTCAACGGAAGCGGCGCGAGACCAAGCTCTACGAGACCAAGCTCTACTGCAAGGGCTACTGCAAGGGCTGCCAGCAGGCCATGCCAGCAGGCCATGCTCCATGGCTATTCAACGAAGCCTTCAACAGCCAGACTTCAACAGCCAGACCATGCGTGGTGACCATGCGTGGTCGCGCCAATGTAGTGGTCGCGCCAATGTAGCCAAGGCGCCAATGTAGCCAAGGCCACCTGGGCTGGGCCTCGTTGGGACTCGTCTAC

Full Affymetrix probeset data:

Annotations for 1636109_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720