Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636112_s_at:

>probe:Drosophila_2:1636112_s_at:192:673; Interrogation_Position=124; Antisense; TATCTTTCGGAAATGGATTACCCTT
>probe:Drosophila_2:1636112_s_at:322:391; Interrogation_Position=224; Antisense; GAAATTCGATGATCTACAAAAACGT
>probe:Drosophila_2:1636112_s_at:483:421; Interrogation_Position=315; Antisense; GAGAAGGTTGAAAACTGCCACCAAT
>probe:Drosophila_2:1636112_s_at:501:465; Interrogation_Position=321; Antisense; GTTGAAAACTGCCACCAATGCAAGA
>probe:Drosophila_2:1636112_s_at:451:127; Interrogation_Position=334; Antisense; ACCAATGCAAGAAACCCGTGTACAA
>probe:Drosophila_2:1636112_s_at:423:297; Interrogation_Position=348; Antisense; CCCGTGTACAAAATGGAGGAAGTCA
>probe:Drosophila_2:1636112_s_at:301:547; Interrogation_Position=362; Antisense; GGAGGAAGTCATTCTTAGTTTGAAG
>probe:Drosophila_2:1636112_s_at:22:497; Interrogation_Position=369; Antisense; GTCATTCTTAGTTTGAAGACAGCAA
>probe:Drosophila_2:1636112_s_at:80:213; Interrogation_Position=384; Antisense; AAGACAGCAACGACTATTTTCCATA
>probe:Drosophila_2:1636112_s_at:428:687; Interrogation_Position=398; Antisense; TATTTTCCATAAAACGTGCTTACGT
>probe:Drosophila_2:1636112_s_at:350:139; Interrogation_Position=411; Antisense; ACGTGCTTACGTTGCAAGGACTGTG
>probe:Drosophila_2:1636112_s_at:661:555; Interrogation_Position=428; Antisense; GGACTGTGGCAAACACCTTAAGTGA
>probe:Drosophila_2:1636112_s_at:462:359; Interrogation_Position=74; Antisense; GCAAGCCGTTTAAACTAACATGGAC
>probe:Drosophila_2:1636112_s_at:265:265; Interrogation_Position=92; Antisense; CATGGACAGTCTAAACCCCCAAAGT

Paste this into a BLAST search page for me
TATCTTTCGGAAATGGATTACCCTTGAAATTCGATGATCTACAAAAACGTGAGAAGGTTGAAAACTGCCACCAATGTTGAAAACTGCCACCAATGCAAGAACCAATGCAAGAAACCCGTGTACAACCCGTGTACAAAATGGAGGAAGTCAGGAGGAAGTCATTCTTAGTTTGAAGGTCATTCTTAGTTTGAAGACAGCAAAAGACAGCAACGACTATTTTCCATATATTTTCCATAAAACGTGCTTACGTACGTGCTTACGTTGCAAGGACTGTGGGACTGTGGCAAACACCTTAAGTGAGCAAGCCGTTTAAACTAACATGGACCATGGACAGTCTAAACCCCCAAAGT

Full Affymetrix probeset data:

Annotations for 1636112_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime