FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636118_at:

>probe:Drosophila_2:1636118_at:293:621; Interrogation_Position=117; Antisense; TGCTCCTGGCTATTTGGGCGGATTA
>probe:Drosophila_2:1636118_at:400:39; Interrogation_Position=181; Antisense; ATCTCCTATGGACACGCCTTGGCTG
>probe:Drosophila_2:1636118_at:416:305; Interrogation_Position=291; Antisense; CCTTTCCGCCTACGGATTGGGATAT
>probe:Drosophila_2:1636118_at:547:1; Interrogation_Position=306; Antisense; ATTGGGATATGGTCCCGGTCCCATT
>probe:Drosophila_2:1636118_at:533:3; Interrogation_Position=328; Antisense; ATTGGCCTGGCTCATGGTCCTTTGG
>probe:Drosophila_2:1636118_at:160:65; Interrogation_Position=341; Antisense; ATGGTCCTTTGGGACTAGCTCACGC
>probe:Drosophila_2:1636118_at:240:321; Interrogation_Position=376; Antisense; GCTCCCTTGGGATTGGGCTACAAGT
>probe:Drosophila_2:1636118_at:269:219; Interrogation_Position=397; Antisense; AAGTCGGCATATCCTACTCTGGGTG
>probe:Drosophila_2:1636118_at:374:337; Interrogation_Position=421; Antisense; GCTCCTCTGGGACTGGGCTACAAGA
>probe:Drosophila_2:1636118_at:345:665; Interrogation_Position=439; Antisense; TACAAGACAGCTCTTGCTGCTCCTG
>probe:Drosophila_2:1636118_at:449:307; Interrogation_Position=464; Antisense; CCTATGGACTCGCTCATGGATGGTA
>probe:Drosophila_2:1636118_at:473:471; Interrogation_Position=485; Antisense; GGTAAACGAGGTCCATACCACCCAT
>probe:Drosophila_2:1636118_at:146:701; Interrogation_Position=515; Antisense; TTTTCCGCATGCATTTCGTTTTGTT
>probe:Drosophila_2:1636118_at:227:637; Interrogation_Position=530; Antisense; TCGTTTTGTTTGGATCGGTCAGAAA

Paste this into a BLAST search page for me
TGCTCCTGGCTATTTGGGCGGATTAATCTCCTATGGACACGCCTTGGCTGCCTTTCCGCCTACGGATTGGGATATATTGGGATATGGTCCCGGTCCCATTATTGGCCTGGCTCATGGTCCTTTGGATGGTCCTTTGGGACTAGCTCACGCGCTCCCTTGGGATTGGGCTACAAGTAAGTCGGCATATCCTACTCTGGGTGGCTCCTCTGGGACTGGGCTACAAGATACAAGACAGCTCTTGCTGCTCCTGCCTATGGACTCGCTCATGGATGGTAGGTAAACGAGGTCCATACCACCCATTTTTCCGCATGCATTTCGTTTTGTTTCGTTTTGTTTGGATCGGTCAGAAA

Full Affymetrix probeset data:

Annotations for 1636118_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720