FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636119_at:

>probe:Drosophila_2:1636119_at:386:427; Interrogation_Position=167; Antisense; GAGATCATCGAGGTCAAGGACGTCT
>probe:Drosophila_2:1636119_at:595:249; Interrogation_Position=181; Antisense; CAAGGACGTCTACTACCGAAAGCGG
>probe:Drosophila_2:1636119_at:317:253; Interrogation_Position=208; Antisense; CAAGAAGTTGGTTGTCCAGCTCGAT
>probe:Drosophila_2:1636119_at:636:385; Interrogation_Position=250; Antisense; GAAAATTCGCTGTGACTTCGATCCA
>probe:Drosophila_2:1636119_at:96:403; Interrogation_Position=263; Antisense; GACTTCGATCCAAGCAATCCGGAGT
>probe:Drosophila_2:1636119_at:476:485; Interrogation_Position=296; Antisense; GTAGTGAAGAAACCCGTGGCTCCTA
>probe:Drosophila_2:1636119_at:340:381; Interrogation_Position=483; Antisense; GAACCGACAGAAGCACCAGATACAG
>probe:Drosophila_2:1636119_at:129:471; Interrogation_Position=524; Antisense; GTTCGGCGACAATGAAGAGGACTCT
>probe:Drosophila_2:1636119_at:691:547; Interrogation_Position=584; Antisense; GGAGTATCAGGAGGTTGACCCCTAT
>probe:Drosophila_2:1636119_at:14:609; Interrogation_Position=599; Antisense; TGACCCCTATGGCACTTACGATAGC
>probe:Drosophila_2:1636119_at:327:669; Interrogation_Position=615; Antisense; TACGATAGCCAAATCCACTCAATTG
>probe:Drosophila_2:1636119_at:304:525; Interrogation_Position=640; Antisense; GGGCTAATGATGACGGCAACTGGAA
>probe:Drosophila_2:1636119_at:198:451; Interrogation_Position=691; Antisense; GATCGATTCGATCTGTTGACTCAAT
>probe:Drosophila_2:1636119_at:690:565; Interrogation_Position=732; Antisense; GGCAATAGCGGAACTGCGCTACATA

Paste this into a BLAST search page for me
GAGATCATCGAGGTCAAGGACGTCTCAAGGACGTCTACTACCGAAAGCGGCAAGAAGTTGGTTGTCCAGCTCGATGAAAATTCGCTGTGACTTCGATCCAGACTTCGATCCAAGCAATCCGGAGTGTAGTGAAGAAACCCGTGGCTCCTAGAACCGACAGAAGCACCAGATACAGGTTCGGCGACAATGAAGAGGACTCTGGAGTATCAGGAGGTTGACCCCTATTGACCCCTATGGCACTTACGATAGCTACGATAGCCAAATCCACTCAATTGGGGCTAATGATGACGGCAACTGGAAGATCGATTCGATCTGTTGACTCAATGGCAATAGCGGAACTGCGCTACATA

Full Affymetrix probeset data:

Annotations for 1636119_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720