FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636121_at:

>probe:Drosophila_2:1636121_at:521:661; Interrogation_Position=276; Antisense; TAAAAAATTCGGCATCTGGCAGCTG
>probe:Drosophila_2:1636121_at:160:187; Interrogation_Position=301; Antisense; AACAAGCGCCAAAAGCCGGGATCCG
>probe:Drosophila_2:1636121_at:183:389; Interrogation_Position=351; Antisense; GAAAAAGGCTTCCACTTCCGAGGCT
>probe:Drosophila_2:1636121_at:82:487; Interrogation_Position=376; Antisense; GTAGATATTCTACCTCCTGAGCGAC
>probe:Drosophila_2:1636121_at:712:609; Interrogation_Position=393; Antisense; TGAGCGACGTTTTGAGCCGCACCAG
>probe:Drosophila_2:1636121_at:730:647; Interrogation_Position=461; Antisense; TCACCTACATGGAGGCAGCTGTCGG
>probe:Drosophila_2:1636121_at:191:501; Interrogation_Position=481; Antisense; GTCGGTCCATTGGAACTCCTAACGA
>probe:Drosophila_2:1636121_at:148:661; Interrogation_Position=500; Antisense; TAACGAAGTGTATATCCCCTGCTAG
>probe:Drosophila_2:1636121_at:730:591; Interrogation_Position=560; Antisense; TGGTGATTCGCAAACACGGATCGGT
>probe:Drosophila_2:1636121_at:8:613; Interrogation_Position=603; Antisense; TGAACTGTTGGCCTTTGACAAGCAG
>probe:Drosophila_2:1636121_at:260:51; Interrogation_Position=699; Antisense; ATGCGACACACCTGTTGATTGCACA
>probe:Drosophila_2:1636121_at:8:153; Interrogation_Position=721; Antisense; ACAGGCCGCCTCAAGGAGTTGGGTA
>probe:Drosophila_2:1636121_at:480:427; Interrogation_Position=736; Antisense; GAGTTGGGTATCACTCTTCCCAGGA
>probe:Drosophila_2:1636121_at:232:417; Interrogation_Position=805; Antisense; GAGCTCCCACAGATTTTAATACGCG

Paste this into a BLAST search page for me
TAAAAAATTCGGCATCTGGCAGCTGAACAAGCGCCAAAAGCCGGGATCCGGAAAAAGGCTTCCACTTCCGAGGCTGTAGATATTCTACCTCCTGAGCGACTGAGCGACGTTTTGAGCCGCACCAGTCACCTACATGGAGGCAGCTGTCGGGTCGGTCCATTGGAACTCCTAACGATAACGAAGTGTATATCCCCTGCTAGTGGTGATTCGCAAACACGGATCGGTTGAACTGTTGGCCTTTGACAAGCAGATGCGACACACCTGTTGATTGCACAACAGGCCGCCTCAAGGAGTTGGGTAGAGTTGGGTATCACTCTTCCCAGGAGAGCTCCCACAGATTTTAATACGCG

Full Affymetrix probeset data:

Annotations for 1636121_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720