FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636122_at:

>probe:Drosophila_2:1636122_at:258:409; Interrogation_Position=2544; Antisense; GACGAATGCAATCCAGGAGCCCCGG
>probe:Drosophila_2:1636122_at:258:351; Interrogation_Position=2574; Antisense; GCAGTTCACCTCCAGCATTGAGAAA
>probe:Drosophila_2:1636122_at:9:373; Interrogation_Position=2649; Antisense; GAAGGTGCTATCCAGCGAACCGGAC
>probe:Drosophila_2:1636122_at:690:13; Interrogation_Position=2708; Antisense; ATTACATCTTCTCCCTGAGCTTCAA
>probe:Drosophila_2:1636122_at:700:251; Interrogation_Position=2730; Antisense; CAAGCTGAACAACTGTGTGCGACAT
>probe:Drosophila_2:1636122_at:487:325; Interrogation_Position=2748; Antisense; GCGACATGTGCGCATCGAGCAAGAT
>probe:Drosophila_2:1636122_at:35:561; Interrogation_Position=2776; Antisense; GGAACCTTTTCCTTTGGCTCGTATG
>probe:Drosophila_2:1636122_at:632:103; Interrogation_Position=2816; Antisense; AGACCATCACCGAGTTCATTGAGAA
>probe:Drosophila_2:1636122_at:474:725; Interrogation_Position=2834; Antisense; TTGAGAAGGCCGTCGAGCATTCGCG
>probe:Drosophila_2:1636122_at:247:719; Interrogation_Position=2853; Antisense; TTCGCGGAGCGGCAGATATCTCTTC
>probe:Drosophila_2:1636122_at:164:97; Interrogation_Position=2866; Antisense; AGATATCTCTTCTTTCTGCATCGTC
>probe:Drosophila_2:1636122_at:272:579; Interrogation_Position=2891; Antisense; GGCCTGAGCACGGACCAATGCGAGT
>probe:Drosophila_2:1636122_at:54:327; Interrogation_Position=2910; Antisense; GCGAGTGCAATTAACCAATCCAGTA
>probe:Drosophila_2:1636122_at:698:401; Interrogation_Position=3018; Antisense; GACATTGCCATTACCGAGAAGACTT

Paste this into a BLAST search page for me
GACGAATGCAATCCAGGAGCCCCGGGCAGTTCACCTCCAGCATTGAGAAAGAAGGTGCTATCCAGCGAACCGGACATTACATCTTCTCCCTGAGCTTCAACAAGCTGAACAACTGTGTGCGACATGCGACATGTGCGCATCGAGCAAGATGGAACCTTTTCCTTTGGCTCGTATGAGACCATCACCGAGTTCATTGAGAATTGAGAAGGCCGTCGAGCATTCGCGTTCGCGGAGCGGCAGATATCTCTTCAGATATCTCTTCTTTCTGCATCGTCGGCCTGAGCACGGACCAATGCGAGTGCGAGTGCAATTAACCAATCCAGTAGACATTGCCATTACCGAGAAGACTT

Full Affymetrix probeset data:

Annotations for 1636122_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720