FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636123_at:

>probe:Drosophila_2:1636123_at:174:539; Interrogation_Position=1034; Antisense; GGTTCGAAACTGACACCATTTTGGT
>probe:Drosophila_2:1636123_at:130:157; Interrogation_Position=1046; Antisense; ACACCATTTTGGTCGTGGCTGCAAA
>probe:Drosophila_2:1636123_at:342:583; Interrogation_Position=1118; Antisense; TGGCGGATTGCCTCCATACAGAAGA
>probe:Drosophila_2:1636123_at:509:727; Interrogation_Position=1161; Antisense; TTGGAGGGCATCTCATTCCCAATAT
>probe:Drosophila_2:1636123_at:465:15; Interrogation_Position=1194; Antisense; ATTTTGTGTCGAACTTACTCCGCTG
>probe:Drosophila_2:1636123_at:672:333; Interrogation_Position=1215; Antisense; GCTGTCGTGCATTACCAAAACTCTT
>probe:Drosophila_2:1636123_at:222:179; Interrogation_Position=1248; Antisense; AAACTCTATTTTTGTAGGCCTGATA
>probe:Drosophila_2:1636123_at:254:693; Interrogation_Position=817; Antisense; TTTGATGCACGGCTTTCATTTCCTC
>probe:Drosophila_2:1636123_at:132:457; Interrogation_Position=872; Antisense; GATACCCAGTGTGGCTTCAAGCTGT
>probe:Drosophila_2:1636123_at:539:379; Interrogation_Position=903; Antisense; GAACGACGGCCAGGAAACTCTTCAC
>probe:Drosophila_2:1636123_at:483:193; Interrogation_Position=918; Antisense; AACTCTTCACCAGTCTGCATGTGGA
>probe:Drosophila_2:1636123_at:680:123; Interrogation_Position=942; Antisense; AGCGCTGGGCCTTTGATGTTGAGCT
>probe:Drosophila_2:1636123_at:684:607; Interrogation_Position=961; Antisense; TGAGCTGCTGTACCTCGCTGAGAAT
>probe:Drosophila_2:1636123_at:47:209; Interrogation_Position=989; Antisense; AAGCTACCAATGTCCGAGGTTGCCG

Paste this into a BLAST search page for me
GGTTCGAAACTGACACCATTTTGGTACACCATTTTGGTCGTGGCTGCAAATGGCGGATTGCCTCCATACAGAAGATTGGAGGGCATCTCATTCCCAATATATTTTGTGTCGAACTTACTCCGCTGGCTGTCGTGCATTACCAAAACTCTTAAACTCTATTTTTGTAGGCCTGATATTTGATGCACGGCTTTCATTTCCTCGATACCCAGTGTGGCTTCAAGCTGTGAACGACGGCCAGGAAACTCTTCACAACTCTTCACCAGTCTGCATGTGGAAGCGCTGGGCCTTTGATGTTGAGCTTGAGCTGCTGTACCTCGCTGAGAATAAGCTACCAATGTCCGAGGTTGCCG

Full Affymetrix probeset data:

Annotations for 1636123_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720