FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636128_at:

>probe:Drosophila_2:1636128_at:222:23; Interrogation_Position=147; Antisense; ATATCGATGGAGAGTCGCCAGGCCA
>probe:Drosophila_2:1636128_at:377:69; Interrogation_Position=166; Antisense; AGGCCAGCAGTTTCGATGACCTCAT
>probe:Drosophila_2:1636128_at:728:417; Interrogation_Position=192; Antisense; GAGCTGACCAACAACTCGGAGCGTC
>probe:Drosophila_2:1636128_at:10:255; Interrogation_Position=203; Antisense; CAACTCGGAGCGTCTGATGGCCAGA
>probe:Drosophila_2:1636128_at:251:439; Interrogation_Position=218; Antisense; GATGGCCAGAGTCAATTCCAGCTTG
>probe:Drosophila_2:1636128_at:60:589; Interrogation_Position=241; Antisense; TGGATGACCTAAACACCGCCCTCGA
>probe:Drosophila_2:1636128_at:678:295; Interrogation_Position=263; Antisense; CGACAACCTGGAGGCTCGAACGGAC
>probe:Drosophila_2:1636128_at:287:471; Interrogation_Position=291; Antisense; GTTCTGGTCGAGATTCGGAGGCTAA
>probe:Drosophila_2:1636128_at:618:655; Interrogation_Position=313; Antisense; TAATCAGCTCGGAAATGCCGGCACA
>probe:Drosophila_2:1636128_at:333:167; Interrogation_Position=325; Antisense; AAATGCCGGCACAAGGTCCGCACGA
>probe:Drosophila_2:1636128_at:450:503; Interrogation_Position=340; Antisense; GTCCGCACGATGGATGTGGCGATCC
>probe:Drosophila_2:1636128_at:695:285; Interrogation_Position=382; Antisense; CGGGCGAATGGCTGTGATACGTAAT
>probe:Drosophila_2:1636128_at:105:701; Interrogation_Position=82; Antisense; TTTTCCCAGCCCTTAAAGCCCAGAT
>probe:Drosophila_2:1636128_at:205:175; Interrogation_Position=96; Antisense; AAAGCCCAGATGGACAGCGCCGATG

Paste this into a BLAST search page for me
ATATCGATGGAGAGTCGCCAGGCCAAGGCCAGCAGTTTCGATGACCTCATGAGCTGACCAACAACTCGGAGCGTCCAACTCGGAGCGTCTGATGGCCAGAGATGGCCAGAGTCAATTCCAGCTTGTGGATGACCTAAACACCGCCCTCGACGACAACCTGGAGGCTCGAACGGACGTTCTGGTCGAGATTCGGAGGCTAATAATCAGCTCGGAAATGCCGGCACAAAATGCCGGCACAAGGTCCGCACGAGTCCGCACGATGGATGTGGCGATCCCGGGCGAATGGCTGTGATACGTAATTTTTCCCAGCCCTTAAAGCCCAGATAAAGCCCAGATGGACAGCGCCGATG

Full Affymetrix probeset data:

Annotations for 1636128_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720