FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636130_at:

>probe:Drosophila_2:1636130_at:76:711; Interrogation_Position=316; Antisense; TTCAACGTGGAGCAGGTCACCTACA
>probe:Drosophila_2:1636130_at:349:379; Interrogation_Position=342; Antisense; GAACCTCAAGTTCCAGGTCTGGGAT
>probe:Drosophila_2:1636130_at:165:413; Interrogation_Position=389; Antisense; GACCTTATTGGCGTTGCTACTACAG
>probe:Drosophila_2:1636130_at:146:359; Interrogation_Position=413; Antisense; GCAACACGGACGCAATCATCTATGT
>probe:Drosophila_2:1636130_at:254:271; Interrogation_Position=429; Antisense; CATCTATGTGGTGGACTCGGCGGAC
>probe:Drosophila_2:1636130_at:331:455; Interrogation_Position=522; Antisense; GATACTGGTCGTCCTGGCGAACAAG
>probe:Drosophila_2:1636130_at:93:299; Interrogation_Position=573; Antisense; CGCCGAGGTCCATCATGCGTTAGGA
>probe:Drosophila_2:1636130_at:184:551; Interrogation_Position=600; Antisense; GGAGAACCTAAAGAACCGCACATTT
>probe:Drosophila_2:1636130_at:144:689; Interrogation_Position=629; Antisense; TATTCAAAACGTCGGCCACCAAGGG
>probe:Drosophila_2:1636130_at:68:81; Interrogation_Position=656; Antisense; AGGGACTCGACCAGGCCATGGACTG
>probe:Drosophila_2:1636130_at:554:187; Interrogation_Position=688; Antisense; AACACCCTGCAGAGTCGCAAGTAGA
>probe:Drosophila_2:1636130_at:204:91; Interrogation_Position=707; Antisense; AGTAGATACTTAGCCAGTCCTCAGA
>probe:Drosophila_2:1636130_at:280:169; Interrogation_Position=752; Antisense; AAATGTGTGTCCAAAGCATCGCCAG
>probe:Drosophila_2:1636130_at:425:347; Interrogation_Position=767; Antisense; GCATCGCCAGCTAGGGAACGTCAAC

Paste this into a BLAST search page for me
TTCAACGTGGAGCAGGTCACCTACAGAACCTCAAGTTCCAGGTCTGGGATGACCTTATTGGCGTTGCTACTACAGGCAACACGGACGCAATCATCTATGTCATCTATGTGGTGGACTCGGCGGACGATACTGGTCGTCCTGGCGAACAAGCGCCGAGGTCCATCATGCGTTAGGAGGAGAACCTAAAGAACCGCACATTTTATTCAAAACGTCGGCCACCAAGGGAGGGACTCGACCAGGCCATGGACTGAACACCCTGCAGAGTCGCAAGTAGAAGTAGATACTTAGCCAGTCCTCAGAAAATGTGTGTCCAAAGCATCGCCAGGCATCGCCAGCTAGGGAACGTCAAC

Full Affymetrix probeset data:

Annotations for 1636130_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720