Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636131_at:

>probe:Drosophila_2:1636131_at:311:535; Interrogation_Position=1891; Antisense; GGTCCAATACTGGTTCTGATGACGA
>probe:Drosophila_2:1636131_at:182:213; Interrogation_Position=1915; Antisense; AAGACGGAGCTCCTGTGCTCAGCAA
>probe:Drosophila_2:1636131_at:382:171; Interrogation_Position=1953; Antisense; AAAGCGATTCGAAGCTTGTCCCCTT
>probe:Drosophila_2:1636131_at:162:565; Interrogation_Position=2058; Antisense; GGCAATATTGAATCCACTAGCTCGA
>probe:Drosophila_2:1636131_at:682:381; Interrogation_Position=2081; Antisense; GAAACCCCAGTTGTTCGAAGGATTG
>probe:Drosophila_2:1636131_at:475:463; Interrogation_Position=2101; Antisense; GATTGGTGGCACACTTTGCCATGGA
>probe:Drosophila_2:1636131_at:87:447; Interrogation_Position=2144; Antisense; GATGCAGCAGTTTTCACAGCATGGA
>probe:Drosophila_2:1636131_at:594:119; Interrogation_Position=2195; Antisense; AGCTGATCTGGTCTTTTATGCGAAT
>probe:Drosophila_2:1636131_at:212:241; Interrogation_Position=2254; Antisense; AATAACGCTCTATCGTCGTAGCTGC
>probe:Drosophila_2:1636131_at:8:293; Interrogation_Position=2270; Antisense; CGTAGCTGCCGGCACTTGAATGTAA
>probe:Drosophila_2:1636131_at:478:659; Interrogation_Position=2292; Antisense; TAAGCTGGCTCCAAAGCTGTCTCGA
>probe:Drosophila_2:1636131_at:540:455; Interrogation_Position=2315; Antisense; GATACTCAGAGTCGTCAACCTTTTC
>probe:Drosophila_2:1636131_at:669:279; Interrogation_Position=2342; Antisense; CTACACGCCGTGATGATGAAATGAT
>probe:Drosophila_2:1636131_at:529:539; Interrogation_Position=2371; Antisense; GGTATTCTAAATCGTTTGCACTCAG

Paste this into a BLAST search page for me
GGTCCAATACTGGTTCTGATGACGAAAGACGGAGCTCCTGTGCTCAGCAAAAAGCGATTCGAAGCTTGTCCCCTTGGCAATATTGAATCCACTAGCTCGAGAAACCCCAGTTGTTCGAAGGATTGGATTGGTGGCACACTTTGCCATGGAGATGCAGCAGTTTTCACAGCATGGAAGCTGATCTGGTCTTTTATGCGAATAATAACGCTCTATCGTCGTAGCTGCCGTAGCTGCCGGCACTTGAATGTAATAAGCTGGCTCCAAAGCTGTCTCGAGATACTCAGAGTCGTCAACCTTTTCCTACACGCCGTGATGATGAAATGATGGTATTCTAAATCGTTTGCACTCAG

Full Affymetrix probeset data:

Annotations for 1636131_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime