FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636134_at:

>probe:Drosophila_2:1636134_at:435:65; Interrogation_Position=1009; Antisense; ATGGTGCGCAGTGCCATCAAGTACT
>probe:Drosophila_2:1636134_at:397:33; Interrogation_Position=1024; Antisense; ATCAAGTACTGGGTCGAGCGGCACA
>probe:Drosophila_2:1636134_at:692:591; Interrogation_Position=1064; Antisense; TGGTGGCTGCCATCGGCGATACTTA
>probe:Drosophila_2:1636134_at:517:651; Interrogation_Position=1163; Antisense; TCAACGGAGTGAATGTCTACGCCTT
>probe:Drosophila_2:1636134_at:263:271; Interrogation_Position=1185; Antisense; CTTCACAGTCGTCGGATACCTAGGA
>probe:Drosophila_2:1636134_at:16:29; Interrogation_Position=1200; Antisense; ATACCTAGGATACGCGCTGGCCCAG
>probe:Drosophila_2:1636134_at:646:267; Interrogation_Position=1222; Antisense; CAGGTGTTCCACTTTTGCATCTTTG
>probe:Drosophila_2:1636134_at:528:99; Interrogation_Position=1265; Antisense; AGAGTTCATCCGTCATGGAGGCCGC
>probe:Drosophila_2:1636134_at:647:667; Interrogation_Position=1291; Antisense; TACTCGTGCCACTGGTACGATGGCT
>probe:Drosophila_2:1636134_at:657:715; Interrogation_Position=1333; Antisense; TTCGTCCAGATCGTGTGCCAGCAGT
>probe:Drosophila_2:1636134_at:593:623; Interrogation_Position=1378; Antisense; TCGGGAGCGAAATTCTTCACCGTCT
>probe:Drosophila_2:1636134_at:709:129; Interrogation_Position=1441; Antisense; ACCTACTTTATGGTGCTGGTGCAGC
>probe:Drosophila_2:1636134_at:254:397; Interrogation_Position=918; Antisense; GACACTGCAGTCCTTTGGCGGGAAC
>probe:Drosophila_2:1636134_at:663:533; Interrogation_Position=963; Antisense; GGTGAACGGCGCTAATCCCAACGGG

Paste this into a BLAST search page for me
ATGGTGCGCAGTGCCATCAAGTACTATCAAGTACTGGGTCGAGCGGCACATGGTGGCTGCCATCGGCGATACTTATCAACGGAGTGAATGTCTACGCCTTCTTCACAGTCGTCGGATACCTAGGAATACCTAGGATACGCGCTGGCCCAGCAGGTGTTCCACTTTTGCATCTTTGAGAGTTCATCCGTCATGGAGGCCGCTACTCGTGCCACTGGTACGATGGCTTTCGTCCAGATCGTGTGCCAGCAGTTCGGGAGCGAAATTCTTCACCGTCTACCTACTTTATGGTGCTGGTGCAGCGACACTGCAGTCCTTTGGCGGGAACGGTGAACGGCGCTAATCCCAACGGG

Full Affymetrix probeset data:

Annotations for 1636134_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720