FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636135_at:

>probe:Drosophila_2:1636135_at:504:489; Interrogation_Position=144; Antisense; GTACAAGGTGCTACACGGATCACAT
>probe:Drosophila_2:1636135_at:702:29; Interrogation_Position=204; Antisense; ATACAAAGTGCTTGGCTTCTCCACA
>probe:Drosophila_2:1636135_at:671:207; Interrogation_Position=22; Antisense; AAGCTGCTGGCCATAATGCTTCTGC
>probe:Drosophila_2:1636135_at:444:257; Interrogation_Position=225; Antisense; CACACACGGTGGTGGCATTGCCAAG
>probe:Drosophila_2:1636135_at:143:67; Interrogation_Position=281; Antisense; ATGGAGCCCACGGTAGCTACGACAT
>probe:Drosophila_2:1636135_at:73:65; Interrogation_Position=322; Antisense; ATGGGACACGGCGAAATCACATACG
>probe:Drosophila_2:1636135_at:364:119; Interrogation_Position=367; Antisense; AGCGGCAAAGTGATTCCGGCGGCCA
>probe:Drosophila_2:1636135_at:69:719; Interrogation_Position=380; Antisense; TTCCGGCGGCCAGAGACATGATTTT
>probe:Drosophila_2:1636135_at:350:605; Interrogation_Position=398; Antisense; TGATTTTCAATCACTACTCGCGTCA
>probe:Drosophila_2:1636135_at:293:327; Interrogation_Position=417; Antisense; GCGTCACGGCCAAAGCGATGGAACT
>probe:Drosophila_2:1636135_at:720:63; Interrogation_Position=434; Antisense; ATGGAACTGCCGAGGATTACGCCGA
>probe:Drosophila_2:1636135_at:254:7; Interrogation_Position=449; Antisense; ATTACGCCGAGGAGCTGGACGACTT
>probe:Drosophila_2:1636135_at:693:417; Interrogation_Position=460; Antisense; GAGCTGGACGACTTTGTAGACCTAA
>probe:Drosophila_2:1636135_at:472:645; Interrogation_Position=92; Antisense; TAATCATCCACGTGCCGGTCAAGGT

Paste this into a BLAST search page for me
GTACAAGGTGCTACACGGATCACATATACAAAGTGCTTGGCTTCTCCACAAAGCTGCTGGCCATAATGCTTCTGCCACACACGGTGGTGGCATTGCCAAGATGGAGCCCACGGTAGCTACGACATATGGGACACGGCGAAATCACATACGAGCGGCAAAGTGATTCCGGCGGCCATTCCGGCGGCCAGAGACATGATTTTTGATTTTCAATCACTACTCGCGTCAGCGTCACGGCCAAAGCGATGGAACTATGGAACTGCCGAGGATTACGCCGAATTACGCCGAGGAGCTGGACGACTTGAGCTGGACGACTTTGTAGACCTAATAATCATCCACGTGCCGGTCAAGGT

Full Affymetrix probeset data:

Annotations for 1636135_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720