Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636137_at:

>probe:Drosophila_2:1636137_at:698:427; Interrogation_Position=1079; Antisense; GAGTTTTCTGTCACGGAACTGCAGC
>probe:Drosophila_2:1636137_at:313:235; Interrogation_Position=1153; Antisense; AATCCTGCGCAGCATTGGCTACAAA
>probe:Drosophila_2:1636137_at:698:139; Interrogation_Position=1193; Antisense; ACGGGCATCAACTTTGACACTCGAC
>probe:Drosophila_2:1636137_at:282:135; Interrogation_Position=1216; Antisense; ACGCGGTCGCGTTCACAACATTAAT
>probe:Drosophila_2:1636137_at:598:411; Interrogation_Position=1277; Antisense; GACCCTGGACTTTATGTAGCTGGCT
>probe:Drosophila_2:1636137_at:552:521; Interrogation_Position=1313; Antisense; GGGCCCACTGGCGTTATTGTGACCA
>probe:Drosophila_2:1636137_at:119:691; Interrogation_Position=1327; Antisense; TATTGTGACCACCATGAACGGCGCC
>probe:Drosophila_2:1636137_at:422:381; Interrogation_Position=1342; Antisense; GAACGGCGCCTTTGCGGTAGCCAAG
>probe:Drosophila_2:1636137_at:293:289; Interrogation_Position=1356; Antisense; CGGTAGCCAAGACCATCTGCGATGA
>probe:Drosophila_2:1636137_at:687:179; Interrogation_Position=1384; Antisense; AAACACGAATGCTCTGGACACCAGT
>probe:Drosophila_2:1636137_at:596:553; Interrogation_Position=1399; Antisense; GGACACCAGTTCTGTCAAACCAGGA
>probe:Drosophila_2:1636137_at:79:231; Interrogation_Position=1475; Antisense; AATGATTTCGAGAGCGCAGCGGGAA
>probe:Drosophila_2:1636137_at:301:77; Interrogation_Position=1572; Antisense; AGGATTCCATGGGTTGCGGTTGACA
>probe:Drosophila_2:1636137_at:285:327; Interrogation_Position=1587; Antisense; GCGGTTGACAATAGTTTCCTTTTAT

Paste this into a BLAST search page for me
GAGTTTTCTGTCACGGAACTGCAGCAATCCTGCGCAGCATTGGCTACAAAACGGGCATCAACTTTGACACTCGACACGCGGTCGCGTTCACAACATTAATGACCCTGGACTTTATGTAGCTGGCTGGGCCCACTGGCGTTATTGTGACCATATTGTGACCACCATGAACGGCGCCGAACGGCGCCTTTGCGGTAGCCAAGCGGTAGCCAAGACCATCTGCGATGAAAACACGAATGCTCTGGACACCAGTGGACACCAGTTCTGTCAAACCAGGAAATGATTTCGAGAGCGCAGCGGGAAAGGATTCCATGGGTTGCGGTTGACAGCGGTTGACAATAGTTTCCTTTTAT

Full Affymetrix probeset data:

Annotations for 1636137_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime