Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636142_at:

>probe:Drosophila_2:1636142_at:148:437; Interrogation_Position=1194; Antisense; GAGGAGTACCTGCATCTGAAGCTGT
>probe:Drosophila_2:1636142_at:52:585; Interrogation_Position=1218; Antisense; TGGAAGCGCGAGAACTTCGTCGCCT
>probe:Drosophila_2:1636142_at:58:29; Interrogation_Position=1313; Antisense; ATACATGAAGAACCACGGACCCGGC
>probe:Drosophila_2:1636142_at:34:131; Interrogation_Position=1344; Antisense; ACCTTTGAGGATTAGCCGCTGCTCT
>probe:Drosophila_2:1636142_at:17:337; Interrogation_Position=1361; Antisense; GCTGCTCTGCGATGTTCAAGTTTCA
>probe:Drosophila_2:1636142_at:719:183; Interrogation_Position=1397; Antisense; AAAAGTCTGTTGTGTGCGTGTTGTA
>probe:Drosophila_2:1636142_at:371:507; Interrogation_Position=1410; Antisense; GTGCGTGTTGTAAAACCGATCCCAA
>probe:Drosophila_2:1636142_at:536:265; Interrogation_Position=1450; Antisense; CATCCCCATACCGTCTAAATTTTGA
>probe:Drosophila_2:1636142_at:456:243; Interrogation_Position=1529; Antisense; AATTATGTTAATGTCCCGGTGTTGT
>probe:Drosophila_2:1636142_at:100:325; Interrogation_Position=1586; Antisense; GCGATCCGCCAAAACCGGTTCAAGA
>probe:Drosophila_2:1636142_at:514:467; Interrogation_Position=1621; Antisense; GTTCGGTACGCGTCGGCACAGTGTC
>probe:Drosophila_2:1636142_at:335:625; Interrogation_Position=1653; Antisense; TGCCGTGAACGAACCATCCTAGAAC
>probe:Drosophila_2:1636142_at:327:663; Interrogation_Position=1672; Antisense; TAGAACAATTATACCCCTACCTGGC
>probe:Drosophila_2:1636142_at:175:151; Interrogation_Position=1718; Antisense; ACATTCGCGTGTTTCCTAACTAACT

Paste this into a BLAST search page for me
GAGGAGTACCTGCATCTGAAGCTGTTGGAAGCGCGAGAACTTCGTCGCCTATACATGAAGAACCACGGACCCGGCACCTTTGAGGATTAGCCGCTGCTCTGCTGCTCTGCGATGTTCAAGTTTCAAAAAGTCTGTTGTGTGCGTGTTGTAGTGCGTGTTGTAAAACCGATCCCAACATCCCCATACCGTCTAAATTTTGAAATTATGTTAATGTCCCGGTGTTGTGCGATCCGCCAAAACCGGTTCAAGAGTTCGGTACGCGTCGGCACAGTGTCTGCCGTGAACGAACCATCCTAGAACTAGAACAATTATACCCCTACCTGGCACATTCGCGTGTTTCCTAACTAACT

Full Affymetrix probeset data:

Annotations for 1636142_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime