FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636143_at:

>probe:Drosophila_2:1636143_at:394:727; Interrogation_Position=110; Antisense; TTGGCATTCCCGTAGAGAACCTGCA
>probe:Drosophila_2:1636143_at:188:381; Interrogation_Position=126; Antisense; GAACCTGCACTTTGAGTCTGTTACC
>probe:Drosophila_2:1636143_at:19:475; Interrogation_Position=145; Antisense; GTTACCTCGGGCTATGTGCTCAAGG
>probe:Drosophila_2:1636143_at:257:507; Interrogation_Position=160; Antisense; GTGCTCAAGGCGGAGTACTTTCTGC
>probe:Drosophila_2:1636143_at:180:467; Interrogation_Position=275; Antisense; GTTGGATTATTTACCGTGGCATCGA
>probe:Drosophila_2:1636143_at:610:495; Interrogation_Position=304; Antisense; GTCATCGAGAACATGGGCTTGCCCG
>probe:Drosophila_2:1636143_at:541:441; Interrogation_Position=31; Antisense; GATGGTCACCTGAAACGCTTGAGCA
>probe:Drosophila_2:1636143_at:584:571; Interrogation_Position=347; Antisense; GGCTGATTTGTGAGCATGCCGCACT
>probe:Drosophila_2:1636143_at:533:235; Interrogation_Position=386; Antisense; AATCCGGGCTGCTTGGTGAGATCAT
>probe:Drosophila_2:1636143_at:265:119; Interrogation_Position=457; Antisense; AGCTCGGATCGGGAGTATCACACAT
>probe:Drosophila_2:1636143_at:334:685; Interrogation_Position=472; Antisense; TATCACACATCGGAGCACTTTGGCA
>probe:Drosophila_2:1636143_at:358:503; Interrogation_Position=543; Antisense; GTCGCCCATGGAACTGATTAGCCTG
>probe:Drosophila_2:1636143_at:135:675; Interrogation_Position=561; Antisense; TAGCCTGCTGCTGGAAGTCAATGAA
>probe:Drosophila_2:1636143_at:368:349; Interrogation_Position=93; Antisense; GCAGTTCATCGGTGGCATTGGCATT

Paste this into a BLAST search page for me
TTGGCATTCCCGTAGAGAACCTGCAGAACCTGCACTTTGAGTCTGTTACCGTTACCTCGGGCTATGTGCTCAAGGGTGCTCAAGGCGGAGTACTTTCTGCGTTGGATTATTTACCGTGGCATCGAGTCATCGAGAACATGGGCTTGCCCGGATGGTCACCTGAAACGCTTGAGCAGGCTGATTTGTGAGCATGCCGCACTAATCCGGGCTGCTTGGTGAGATCATAGCTCGGATCGGGAGTATCACACATTATCACACATCGGAGCACTTTGGCAGTCGCCCATGGAACTGATTAGCCTGTAGCCTGCTGCTGGAAGTCAATGAAGCAGTTCATCGGTGGCATTGGCATT

Full Affymetrix probeset data:

Annotations for 1636143_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720