Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636145_at:

>probe:Drosophila_2:1636145_at:558:259; Interrogation_Position=1024; Antisense; CACGAGGATCACGAGCTGGGCTGCA
>probe:Drosophila_2:1636145_at:123:253; Interrogation_Position=1047; Antisense; CAAGATCATTGGACTGCCGTACAGG
>probe:Drosophila_2:1636145_at:166:527; Interrogation_Position=1071; Antisense; GGGAAATCTGAGCACCATGTACATC
>probe:Drosophila_2:1636145_at:489:599; Interrogation_Position=1088; Antisense; TGTACATCATCCAGCCGTTTAAGTC
>probe:Drosophila_2:1636145_at:407:533; Interrogation_Position=1203; Antisense; GGTGGCATTCCCAAAGATGCATCTT
>probe:Drosophila_2:1636145_at:729:615; Interrogation_Position=1220; Antisense; TGCATCTTACGGAGTCGGTGAACTT
>probe:Drosophila_2:1636145_at:660:331; Interrogation_Position=1274; Antisense; GCGGCATCTTTAGCGCGGTGCAGAA
>probe:Drosophila_2:1636145_at:426:535; Interrogation_Position=1290; Antisense; GGTGCAGAATGATCTCTCGCTCATC
>probe:Drosophila_2:1636145_at:48:139; Interrogation_Position=1322; Antisense; ACGAGGCCACGAGGACGAATGCGCT
>probe:Drosophila_2:1636145_at:121:473; Interrogation_Position=1432; Antisense; GTTCACAAAGTGGACTTCACCGTCA
>probe:Drosophila_2:1636145_at:698:25; Interrogation_Position=1494; Antisense; ATACCTCAAGAAATCCGGTCCCGAT
>probe:Drosophila_2:1636145_at:582:105; Interrogation_Position=1533; Antisense; AGACACTCCATTCATGGTCCTTGTG
>probe:Drosophila_2:1636145_at:47:139; Interrogation_Position=1562; Antisense; ACGATCCCACGAAACTGGTGCTCTT
>probe:Drosophila_2:1636145_at:587:591; Interrogation_Position=1577; Antisense; TGGTGCTCTTCTACGGACTCATAAA

Paste this into a BLAST search page for me
CACGAGGATCACGAGCTGGGCTGCACAAGATCATTGGACTGCCGTACAGGGGGAAATCTGAGCACCATGTACATCTGTACATCATCCAGCCGTTTAAGTCGGTGGCATTCCCAAAGATGCATCTTTGCATCTTACGGAGTCGGTGAACTTGCGGCATCTTTAGCGCGGTGCAGAAGGTGCAGAATGATCTCTCGCTCATCACGAGGCCACGAGGACGAATGCGCTGTTCACAAAGTGGACTTCACCGTCAATACCTCAAGAAATCCGGTCCCGATAGACACTCCATTCATGGTCCTTGTGACGATCCCACGAAACTGGTGCTCTTTGGTGCTCTTCTACGGACTCATAAA

Full Affymetrix probeset data:

Annotations for 1636145_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime