FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636147_at:

>probe:Drosophila_2:1636147_at:94:143; Interrogation_Position=170; Antisense; ACTGGTTTACCTACAATTCGCTAAG
>probe:Drosophila_2:1636147_at:249:233; Interrogation_Position=243; Antisense; AATGCGATTGCAGTCCTTTCAAAAC
>probe:Drosophila_2:1636147_at:443:439; Interrogation_Position=270; Antisense; GATGGAAACTAAACTTCGGGCTCTA
>probe:Drosophila_2:1636147_at:98:13; Interrogation_Position=357; Antisense; ATTCAAGAAGATTGGCTCCCGGCAC
>probe:Drosophila_2:1636147_at:196:579; Interrogation_Position=369; Antisense; TGGCTCCCGGCACTTTTACTTAGAA
>probe:Drosophila_2:1636147_at:461:593; Interrogation_Position=412; Antisense; TGGGATAGCGCATACGACACGTGTC
>probe:Drosophila_2:1636147_at:360:469; Interrogation_Position=432; Antisense; GTGTCGTCAAATGGGCGGTCACCTG
>probe:Drosophila_2:1636147_at:709:495; Interrogation_Position=449; Antisense; GTCACCTGGCGAATATCCTCGATGA
>probe:Drosophila_2:1636147_at:197:531; Interrogation_Position=521; Antisense; GGGTAGATATCAACAGCCGTGCCAA
>probe:Drosophila_2:1636147_at:700:187; Interrogation_Position=532; Antisense; AACAGCCGTGCCAACGATGGAGCGT
>probe:Drosophila_2:1636147_at:629:439; Interrogation_Position=547; Antisense; GATGGAGCGTCCTGGATTTCTACAC
>probe:Drosophila_2:1636147_at:412:459; Interrogation_Position=561; Antisense; GATTTCTACACTATCCGGAAGGGAT
>probe:Drosophila_2:1636147_at:234:29; Interrogation_Position=686; Antisense; ATAACTATTTTGCTTGCCAAGCCGA
>probe:Drosophila_2:1636147_at:464:721; Interrogation_Position=699; Antisense; TTGCCAAGCCGAGCAATGGGCCTGA

Paste this into a BLAST search page for me
ACTGGTTTACCTACAATTCGCTAAGAATGCGATTGCAGTCCTTTCAAAACGATGGAAACTAAACTTCGGGCTCTAATTCAAGAAGATTGGCTCCCGGCACTGGCTCCCGGCACTTTTACTTAGAATGGGATAGCGCATACGACACGTGTCGTGTCGTCAAATGGGCGGTCACCTGGTCACCTGGCGAATATCCTCGATGAGGGTAGATATCAACAGCCGTGCCAAAACAGCCGTGCCAACGATGGAGCGTGATGGAGCGTCCTGGATTTCTACACGATTTCTACACTATCCGGAAGGGATATAACTATTTTGCTTGCCAAGCCGATTGCCAAGCCGAGCAATGGGCCTGA

Full Affymetrix probeset data:

Annotations for 1636147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720