FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636148_at:

>probe:Drosophila_2:1636148_at:29:581; Interrogation_Position=384; Antisense; TGGCCAATGCATGACCTATTCCAAA
>probe:Drosophila_2:1636148_at:241:441; Interrogation_Position=415; Antisense; GATGGCATCCGTGACTGCCGAGATG
>probe:Drosophila_2:1636148_at:146:695; Interrogation_Position=461; Antisense; TTTGCGAGGGCGTTACCATACCAAC
>probe:Drosophila_2:1636148_at:74:73; Interrogation_Position=535; Antisense; AGGATAACTCCCACTGTTCCTGTAA
>probe:Drosophila_2:1636148_at:366:495; Interrogation_Position=570; Antisense; GTCACGACCAAATCCTCTTCAGGAG
>probe:Drosophila_2:1636148_at:67:717; Interrogation_Position=611; Antisense; TTCCCCAACTGCCAAACGTTATGGT
>probe:Drosophila_2:1636148_at:197:675; Interrogation_Position=677; Antisense; TAGCCAATGGCACCCGTATCTACTA
>probe:Drosophila_2:1636148_at:71:381; Interrogation_Position=735; Antisense; GAACCAGAACATTTGCCAGGACGCA
>probe:Drosophila_2:1636148_at:367:689; Interrogation_Position=775; Antisense; TTTCCTTACTGTGAAACACCCCAAG
>probe:Drosophila_2:1636148_at:706:155; Interrogation_Position=790; Antisense; ACACCCCAAGCGTATGTTTTCAGCT
>probe:Drosophila_2:1636148_at:531:241; Interrogation_Position=825; Antisense; AATATTCTGCTTCCTAATCGTGGTA
>probe:Drosophila_2:1636148_at:162:515; Interrogation_Position=853; Antisense; GTGTTTCTAATTTGGCGGGTGCGTC
>probe:Drosophila_2:1636148_at:472:531; Interrogation_Position=921; Antisense; GGTGGAGACCAGCAGTAATCTTCCC
>probe:Drosophila_2:1636148_at:397:653; Interrogation_Position=936; Antisense; TAATCTTCCCCAGACATCTTCAATA

Paste this into a BLAST search page for me
TGGCCAATGCATGACCTATTCCAAAGATGGCATCCGTGACTGCCGAGATGTTTGCGAGGGCGTTACCATACCAACAGGATAACTCCCACTGTTCCTGTAAGTCACGACCAAATCCTCTTCAGGAGTTCCCCAACTGCCAAACGTTATGGTTAGCCAATGGCACCCGTATCTACTAGAACCAGAACATTTGCCAGGACGCATTTCCTTACTGTGAAACACCCCAAGACACCCCAAGCGTATGTTTTCAGCTAATATTCTGCTTCCTAATCGTGGTAGTGTTTCTAATTTGGCGGGTGCGTCGGTGGAGACCAGCAGTAATCTTCCCTAATCTTCCCCAGACATCTTCAATA

Full Affymetrix probeset data:

Annotations for 1636148_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720