Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636149_at:

>probe:Drosophila_2:1636149_at:243:425; Interrogation_Position=1826; Antisense; GAGACTGCTACTCCAGCCAATGGAA
>probe:Drosophila_2:1636149_at:29:435; Interrogation_Position=1949; Antisense; GAGGGATCTGTACCATTGGCACCCA
>probe:Drosophila_2:1636149_at:380:15; Interrogation_Position=1973; Antisense; ATAGTTCCCGGTGGTCAGCCCGATA
>probe:Drosophila_2:1636149_at:393:213; Interrogation_Position=2003; Antisense; AAGATGCCGGGTCTGACACAGGCTC
>probe:Drosophila_2:1636149_at:694:145; Interrogation_Position=2029; Antisense; ACTCTCGGCGGAATCTATCGTCAAG
>probe:Drosophila_2:1636149_at:248:569; Interrogation_Position=2068; Antisense; GGCAGAGCGAACTTTTGGACACTTT
>probe:Drosophila_2:1636149_at:200:149; Interrogation_Position=2088; Antisense; ACTTTAGCTTCATCTCCACGGTGGT
>probe:Drosophila_2:1636149_at:711:531; Interrogation_Position=2107; Antisense; GGTGGTGACCCTAATCGTGGCCTAC
>probe:Drosophila_2:1636149_at:602:273; Interrogation_Position=2149; Antisense; CATTGCCTCCATACAATCCTTAATT
>probe:Drosophila_2:1636149_at:558:223; Interrogation_Position=2179; Antisense; AAGGACACAGTCTCGTTGGCTACCG
>probe:Drosophila_2:1636149_at:336:337; Interrogation_Position=2197; Antisense; GCTACCGTAATTTATTGCCATTTTA
>probe:Drosophila_2:1636149_at:385:617; Interrogation_Position=2246; Antisense; TGCATATATGTCTATCGCCGGTCAA
>probe:Drosophila_2:1636149_at:233:27; Interrogation_Position=2331; Antisense; ATACTCGTAGTTCTGTTAGACCTGA
>probe:Drosophila_2:1636149_at:284:473; Interrogation_Position=2345; Antisense; GTTAGACCTGAATGTAAGCCACCAA

Paste this into a BLAST search page for me
GAGACTGCTACTCCAGCCAATGGAAGAGGGATCTGTACCATTGGCACCCAATAGTTCCCGGTGGTCAGCCCGATAAAGATGCCGGGTCTGACACAGGCTCACTCTCGGCGGAATCTATCGTCAAGGGCAGAGCGAACTTTTGGACACTTTACTTTAGCTTCATCTCCACGGTGGTGGTGGTGACCCTAATCGTGGCCTACCATTGCCTCCATACAATCCTTAATTAAGGACACAGTCTCGTTGGCTACCGGCTACCGTAATTTATTGCCATTTTATGCATATATGTCTATCGCCGGTCAAATACTCGTAGTTCTGTTAGACCTGAGTTAGACCTGAATGTAAGCCACCAA

Full Affymetrix probeset data:

Annotations for 1636149_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime