FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636151_at:

>probe:Drosophila_2:1636151_at:180:389; Interrogation_Position=120; Antisense; GAAAAATTGGCTAGGCGCTCCCGCT
>probe:Drosophila_2:1636151_at:51:341; Interrogation_Position=142; Antisense; GCTACAATTGTACCCACTCAAGGAT
>probe:Drosophila_2:1636151_at:46:545; Interrogation_Position=163; Antisense; GGATCACATGTGTACGGAGCCATTT
>probe:Drosophila_2:1636151_at:356:625; Interrogation_Position=236; Antisense; TGCCCGCTGGCGTATATGTTCCGAT
>probe:Drosophila_2:1636151_at:622:59; Interrogation_Position=251; Antisense; ATGTTCCGATTAGTGTTCCCGTTCA
>probe:Drosophila_2:1636151_at:628:141; Interrogation_Position=286; Antisense; ACTGATTCAAGCATTACCTGTCGTG
>probe:Drosophila_2:1636151_at:665:707; Interrogation_Position=299; Antisense; TTACCTGTCGTGCATATCACTTGAC
>probe:Drosophila_2:1636151_at:612:559; Interrogation_Position=363; Antisense; GGAAATTATTCCACACGATCGACAG
>probe:Drosophila_2:1636151_at:673:259; Interrogation_Position=385; Antisense; CAGCCTTCGCAAACGTACCTTAAAG
>probe:Drosophila_2:1636151_at:70:215; Interrogation_Position=537; Antisense; AAGAGTTGAGGCACTCCTCTTCAGA
>probe:Drosophila_2:1636151_at:346:701; Interrogation_Position=566; Antisense; TTTTAGCACCTTTCGCTGCTGCAAA
>probe:Drosophila_2:1636151_at:12:559; Interrogation_Position=607; Antisense; GGAAAAGCTTTTGGCCACTTGGCGT
>probe:Drosophila_2:1636151_at:124:329; Interrogation_Position=628; Antisense; GCGTCCGAATTGTGTGTGCCAAAGT
>probe:Drosophila_2:1636151_at:494:139; Interrogation_Position=91; Antisense; AACTTTCGGTTAGACTTTCACACTG

Paste this into a BLAST search page for me
GAAAAATTGGCTAGGCGCTCCCGCTGCTACAATTGTACCCACTCAAGGATGGATCACATGTGTACGGAGCCATTTTGCCCGCTGGCGTATATGTTCCGATATGTTCCGATTAGTGTTCCCGTTCAACTGATTCAAGCATTACCTGTCGTGTTACCTGTCGTGCATATCACTTGACGGAAATTATTCCACACGATCGACAGCAGCCTTCGCAAACGTACCTTAAAGAAGAGTTGAGGCACTCCTCTTCAGATTTTAGCACCTTTCGCTGCTGCAAAGGAAAAGCTTTTGGCCACTTGGCGTGCGTCCGAATTGTGTGTGCCAAAGTAACTTTCGGTTAGACTTTCACACTG

Full Affymetrix probeset data:

Annotations for 1636151_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720