FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636153_at:

>probe:Drosophila_2:1636153_at:343:71; Interrogation_Position=426; Antisense; AGGCTGCCAACTGGTGGTGTCATGT
>probe:Drosophila_2:1636153_at:563:385; Interrogation_Position=471; Antisense; GAACAGCAAGTTCTCTACTCCAGGG
>probe:Drosophila_2:1636153_at:81:545; Interrogation_Position=505; Antisense; GGAGTTTTTTGCTCAACACCCGGAG
>probe:Drosophila_2:1636153_at:28:723; Interrogation_Position=536; Antisense; TTGCCCGGATTATGTCGCGTCCAAA
>probe:Drosophila_2:1636153_at:125:687; Interrogation_Position=568; Antisense; TATATGCTAATGACCGGTCTTCCCG
>probe:Drosophila_2:1636153_at:61:717; Interrogation_Position=587; Antisense; TTCCCGTTACTGGTGAAGAAGCCTA
>probe:Drosophila_2:1636153_at:442:369; Interrogation_Position=620; Antisense; GAATGGTCACCAAAGCTGTTCCTGC
>probe:Drosophila_2:1636153_at:686:183; Interrogation_Position=694; Antisense; AAAAGTCGTGCCGTCATCTCTCTGG
>probe:Drosophila_2:1636153_at:431:471; Interrogation_Position=726; Antisense; GTTCTACTACAAGCAACTGGCCATG
>probe:Drosophila_2:1636153_at:196:11; Interrogation_Position=748; Antisense; ATGTCCCAAGCGGAAGCCTTTTCGG
>probe:Drosophila_2:1636153_at:678:315; Interrogation_Position=763; Antisense; GCCTTTTCGGCTGCGCAGGAGAAGA
>probe:Drosophila_2:1636153_at:407:385; Interrogation_Position=793; Antisense; GAAAATTTCCAGCTGGGCGACACCA
>probe:Drosophila_2:1636153_at:668:81; Interrogation_Position=821; Antisense; AGGGCATTGCTAGCTTCTTCGAGAA
>probe:Drosophila_2:1636153_at:535:585; Interrogation_Position=859; Antisense; TGGAAGCACCAGTAACCGCAACATA

Paste this into a BLAST search page for me
AGGCTGCCAACTGGTGGTGTCATGTGAACAGCAAGTTCTCTACTCCAGGGGGAGTTTTTTGCTCAACACCCGGAGTTGCCCGGATTATGTCGCGTCCAAATATATGCTAATGACCGGTCTTCCCGTTCCCGTTACTGGTGAAGAAGCCTAGAATGGTCACCAAAGCTGTTCCTGCAAAAGTCGTGCCGTCATCTCTCTGGGTTCTACTACAAGCAACTGGCCATGATGTCCCAAGCGGAAGCCTTTTCGGGCCTTTTCGGCTGCGCAGGAGAAGAGAAAATTTCCAGCTGGGCGACACCAAGGGCATTGCTAGCTTCTTCGAGAATGGAAGCACCAGTAACCGCAACATA

Full Affymetrix probeset data:

Annotations for 1636153_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720