FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636154_at:

>probe:Drosophila_2:1636154_at:390:305; Interrogation_Position=428; Antisense; CCTTCGCTTGGCCAAATTTGTGACT
>probe:Drosophila_2:1636154_at:191:511; Interrogation_Position=447; Antisense; GTGACTTTCAAAGCTCACATCTCGC
>probe:Drosophila_2:1636154_at:309:19; Interrogation_Position=474; Antisense; ATTTGCATCATTTTGGGTACCTCCA
>probe:Drosophila_2:1636154_at:581:673; Interrogation_Position=520; Antisense; TAGAATGGTTTGTTGCCACCGGTTG
>probe:Drosophila_2:1636154_at:390:435; Interrogation_Position=571; Antisense; GAGGTGTTCTGCAGATCACCCAGCT
>probe:Drosophila_2:1636154_at:22:125; Interrogation_Position=598; Antisense; AGCGCTATAATTCATCCCAGTGCAT
>probe:Drosophila_2:1636154_at:38:87; Interrogation_Position=616; Antisense; AGTGCATGCAAGCTCTTGGCAGGTT
>probe:Drosophila_2:1636154_at:134:351; Interrogation_Position=647; Antisense; GCAGAACCAAATTTGCGCCGGACGC
>probe:Drosophila_2:1636154_at:146:411; Interrogation_Position=667; Antisense; GACGCCTTGGATCCGATACGTGCAA
>probe:Drosophila_2:1636154_at:297:185; Interrogation_Position=738; Antisense; AAAATGCGTCCCGTGCAATTCGGAG
>probe:Drosophila_2:1636154_at:629:245; Interrogation_Position=754; Antisense; AATTCGGAGTCGTCAGCTACGGCAG
>probe:Drosophila_2:1636154_at:131:433; Interrogation_Position=783; Antisense; GAGTGCTCCGGAATCGGTGTCTATA
>probe:Drosophila_2:1636154_at:541:63; Interrogation_Position=811; Antisense; ATGTGTACAGCTACGCCGATTGGAT
>probe:Drosophila_2:1636154_at:691:3; Interrogation_Position=829; Antisense; ATTGGATCGCAACCGTGGTGCAGCA

Paste this into a BLAST search page for me
CCTTCGCTTGGCCAAATTTGTGACTGTGACTTTCAAAGCTCACATCTCGCATTTGCATCATTTTGGGTACCTCCATAGAATGGTTTGTTGCCACCGGTTGGAGGTGTTCTGCAGATCACCCAGCTAGCGCTATAATTCATCCCAGTGCATAGTGCATGCAAGCTCTTGGCAGGTTGCAGAACCAAATTTGCGCCGGACGCGACGCCTTGGATCCGATACGTGCAAAAAATGCGTCCCGTGCAATTCGGAGAATTCGGAGTCGTCAGCTACGGCAGGAGTGCTCCGGAATCGGTGTCTATAATGTGTACAGCTACGCCGATTGGATATTGGATCGCAACCGTGGTGCAGCA

Full Affymetrix probeset data:

Annotations for 1636154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720