FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636155_at:

>probe:Drosophila_2:1636155_at:556:613; Interrogation_Position=421; Antisense; TGAAGCTTGCAGTGCGACAATGGCA
>probe:Drosophila_2:1636155_at:245:623; Interrogation_Position=433; Antisense; TGCGACAATGGCAAGGCACAGAGCT
>probe:Drosophila_2:1636155_at:446:357; Interrogation_Position=448; Antisense; GCACAGAGCTTGAATGCCTCACATG
>probe:Drosophila_2:1636155_at:45:265; Interrogation_Position=451; Antisense; CAGAGCTTGAATGCCTCACATGTGC
>probe:Drosophila_2:1636155_at:529:651; Interrogation_Position=466; Antisense; TCACATGTGCTCACCGCGGCTGCCT
>probe:Drosophila_2:1636155_at:269:289; Interrogation_Position=482; Antisense; CGGCTGCCTGCATGCCTGCTGTGGC
>probe:Drosophila_2:1636155_at:650:347; Interrogation_Position=491; Antisense; GCATGCCTGCTGTGGCGGAGTCCAT
>probe:Drosophila_2:1636155_at:310:331; Interrogation_Position=505; Antisense; GCGGAGTCCATCAGCAATGGTGTTC
>probe:Drosophila_2:1636155_at:163:433; Interrogation_Position=508; Antisense; GAGTCCATCAGCAATGGTGTTCACT
>probe:Drosophila_2:1636155_at:211:505; Interrogation_Position=510; Antisense; GTCCATCAGCAATGGTGTTCACTAA
>probe:Drosophila_2:1636155_at:397:35; Interrogation_Position=514; Antisense; ATCAGCAATGGTGTTCACTAACTTG
>probe:Drosophila_2:1636155_at:627:227; Interrogation_Position=520; Antisense; AATGGTGTTCACTAACTTGTGGTCC
>probe:Drosophila_2:1636155_at:564:531; Interrogation_Position=523; Antisense; GGTGTTCACTAACTTGTGGTCCTTT
>probe:Drosophila_2:1636155_at:246:601; Interrogation_Position=525; Antisense; TGTTCACTAACTTGTGGTCCTTTTT

Paste this into a BLAST search page for me
TGAAGCTTGCAGTGCGACAATGGCATGCGACAATGGCAAGGCACAGAGCTGCACAGAGCTTGAATGCCTCACATGCAGAGCTTGAATGCCTCACATGTGCTCACATGTGCTCACCGCGGCTGCCTCGGCTGCCTGCATGCCTGCTGTGGCGCATGCCTGCTGTGGCGGAGTCCATGCGGAGTCCATCAGCAATGGTGTTCGAGTCCATCAGCAATGGTGTTCACTGTCCATCAGCAATGGTGTTCACTAAATCAGCAATGGTGTTCACTAACTTGAATGGTGTTCACTAACTTGTGGTCCGGTGTTCACTAACTTGTGGTCCTTTTGTTCACTAACTTGTGGTCCTTTTT

Full Affymetrix probeset data:

Annotations for 1636155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720