Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636156_at:

>probe:Drosophila_2:1636156_at:697:199; Interrogation_Position=3556; Antisense; AACGCTCGACCAATTCAATCTTATC
>probe:Drosophila_2:1636156_at:103:249; Interrogation_Position=3571; Antisense; CAATCTTATCGAGCTTCAATATCAG
>probe:Drosophila_2:1636156_at:362:159; Interrogation_Position=3615; Antisense; ACAAATGCGCACACCGATTCGAATT
>probe:Drosophila_2:1636156_at:611:691; Interrogation_Position=3643; Antisense; TTTGCAAACATATTCCTTCCATTCC
>probe:Drosophila_2:1636156_at:138:303; Interrogation_Position=3669; Antisense; CCCGCATTTATAATCCGAACAAGCT
>probe:Drosophila_2:1636156_at:711:357; Interrogation_Position=3745; Antisense; GCAAATCTGCAACTTATGCTCGAAA
>probe:Drosophila_2:1636156_at:673:695; Interrogation_Position=3860; Antisense; TTTCCCTTGGAAAGCATTCTGCACT
>probe:Drosophila_2:1636156_at:466:147; Interrogation_Position=3882; Antisense; ACTATCTCAGCATCTCTGCTAACTA
>probe:Drosophila_2:1636156_at:700:649; Interrogation_Position=3957; Antisense; TAATTTCTCGAATCGTAAGCGTAGT
>probe:Drosophila_2:1636156_at:72:219; Interrogation_Position=4005; Antisense; AAGTCAGCATCGCTTATTTCCTACA
>probe:Drosophila_2:1636156_at:384:19; Interrogation_Position=4020; Antisense; ATTTCCTACATACACTGAACGCATT
>probe:Drosophila_2:1636156_at:225:725; Interrogation_Position=4053; Antisense; TTGAATTTGTGGCAGCTTCTCTCAT
>probe:Drosophila_2:1636156_at:353:117; Interrogation_Position=4066; Antisense; AGCTTCTCTCATTCTGTAGCATCTA
>probe:Drosophila_2:1636156_at:60:425; Interrogation_Position=4092; Antisense; GAGAGTCCGATGAATATACGTTACT

Paste this into a BLAST search page for me
AACGCTCGACCAATTCAATCTTATCCAATCTTATCGAGCTTCAATATCAGACAAATGCGCACACCGATTCGAATTTTTGCAAACATATTCCTTCCATTCCCCCGCATTTATAATCCGAACAAGCTGCAAATCTGCAACTTATGCTCGAAATTTCCCTTGGAAAGCATTCTGCACTACTATCTCAGCATCTCTGCTAACTATAATTTCTCGAATCGTAAGCGTAGTAAGTCAGCATCGCTTATTTCCTACAATTTCCTACATACACTGAACGCATTTTGAATTTGTGGCAGCTTCTCTCATAGCTTCTCTCATTCTGTAGCATCTAGAGAGTCCGATGAATATACGTTACT

Full Affymetrix probeset data:

Annotations for 1636156_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime