FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636157_at:

>probe:Drosophila_2:1636157_at:323:557; Interrogation_Position=1098; Antisense; GGACGTGACTCTGCTGGTTCATGGA
>probe:Drosophila_2:1636157_at:208:331; Interrogation_Position=1141; Antisense; GCGGAACGTGTGACCAATGCCTTAT
>probe:Drosophila_2:1636157_at:132:693; Interrogation_Position=1202; Antisense; TTTCCGAGATCCAGCAGACTTTTCA
>probe:Drosophila_2:1636157_at:26:101; Interrogation_Position=1217; Antisense; AGACTTTTCAGGGTGCTACTATGGT
>probe:Drosophila_2:1636157_at:242:65; Interrogation_Position=1237; Antisense; ATGGTGAACCTGTTGACCGAGCCAG
>probe:Drosophila_2:1636157_at:77:565; Interrogation_Position=1261; Antisense; GGAATGTCCATCCTAGAGCTCGCCA
>probe:Drosophila_2:1636157_at:218:227; Interrogation_Position=1288; Antisense; AAGGCGAAGTGCTTTCCCACGGAGA
>probe:Drosophila_2:1636157_at:203:303; Interrogation_Position=1304; Antisense; CCACGGAGACGGATGCTGTACGCAT
>probe:Drosophila_2:1636157_at:54:349; Interrogation_Position=1336; Antisense; GCAGGCGGATTTTACGTTAACCAGA
>probe:Drosophila_2:1636157_at:176:365; Interrogation_Position=1371; Antisense; GAATATCGCCGAAGTGCTAACTACG
>probe:Drosophila_2:1636157_at:481:195; Interrogation_Position=1414; Antisense; AACGGAATTTCTCTGCTGCGCGTGG
>probe:Drosophila_2:1636157_at:698:289; Interrogation_Position=1434; Antisense; CGTGGGCAAACGCAACTTCTATATT
>probe:Drosophila_2:1636157_at:92:347; Interrogation_Position=968; Antisense; GCATGCCAGACTCCGAGGTCGAAAA
>probe:Drosophila_2:1636157_at:52:183; Interrogation_Position=989; Antisense; AAAAGCTCCTGAAGCTGTTCACCTT

Paste this into a BLAST search page for me
GGACGTGACTCTGCTGGTTCATGGAGCGGAACGTGTGACCAATGCCTTATTTTCCGAGATCCAGCAGACTTTTCAAGACTTTTCAGGGTGCTACTATGGTATGGTGAACCTGTTGACCGAGCCAGGGAATGTCCATCCTAGAGCTCGCCAAAGGCGAAGTGCTTTCCCACGGAGACCACGGAGACGGATGCTGTACGCATGCAGGCGGATTTTACGTTAACCAGAGAATATCGCCGAAGTGCTAACTACGAACGGAATTTCTCTGCTGCGCGTGGCGTGGGCAAACGCAACTTCTATATTGCATGCCAGACTCCGAGGTCGAAAAAAAAGCTCCTGAAGCTGTTCACCTT

Full Affymetrix probeset data:

Annotations for 1636157_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720