Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636158_at:

>probe:Drosophila_2:1636158_at:478:175; Interrogation_Position=2335; Antisense; AAACCAATTGTACCTGCTCAAGCAC
>probe:Drosophila_2:1636158_at:11:659; Interrogation_Position=2394; Antisense; TAAGTCCACTCAGCTGGTCAGCAGA
>probe:Drosophila_2:1636158_at:363:649; Interrogation_Position=2411; Antisense; TCAGCAGACCCTATGTCAGCAGCGA
>probe:Drosophila_2:1636158_at:619:399; Interrogation_Position=2434; Antisense; GACAGTTTCCGCAATGAGTCCAACT
>probe:Drosophila_2:1636158_at:198:191; Interrogation_Position=2491; Antisense; AACTACTCGTACAACTACTCGTGCA
>probe:Drosophila_2:1636158_at:241:667; Interrogation_Position=2530; Antisense; TACTCGTCCAACTGTAGGTTTGACT
>probe:Drosophila_2:1636158_at:426:703; Interrogation_Position=2549; Antisense; TTGACTACTTACCAACCTACTCGTA
>probe:Drosophila_2:1636158_at:533:301; Interrogation_Position=2590; Antisense; CCGACGCCCAATTTATACAACTCAA
>probe:Drosophila_2:1636158_at:459:357; Interrogation_Position=2639; Antisense; GCAACAACACCGTATCCAACAGTAA
>probe:Drosophila_2:1636158_at:480:127; Interrogation_Position=2698; Antisense; ACCACTTACAACCACTCGATATATT
>probe:Drosophila_2:1636158_at:676:159; Interrogation_Position=2777; Antisense; ACAACGATTCGTTACTCACCAACAA
>probe:Drosophila_2:1636158_at:93:629; Interrogation_Position=2825; Antisense; TCCACCACTCGTTATTCAGCGATAA
>probe:Drosophila_2:1636158_at:541:139; Interrogation_Position=2849; Antisense; ACGGCATTTTCAACTCGTCAAACAA
>probe:Drosophila_2:1636158_at:332:579; Interrogation_Position=2886; Antisense; GGCCATACTTATTTACCTCAACGAC

Paste this into a BLAST search page for me
AAACCAATTGTACCTGCTCAAGCACTAAGTCCACTCAGCTGGTCAGCAGATCAGCAGACCCTATGTCAGCAGCGAGACAGTTTCCGCAATGAGTCCAACTAACTACTCGTACAACTACTCGTGCATACTCGTCCAACTGTAGGTTTGACTTTGACTACTTACCAACCTACTCGTACCGACGCCCAATTTATACAACTCAAGCAACAACACCGTATCCAACAGTAAACCACTTACAACCACTCGATATATTACAACGATTCGTTACTCACCAACAATCCACCACTCGTTATTCAGCGATAAACGGCATTTTCAACTCGTCAAACAAGGCCATACTTATTTACCTCAACGAC

Full Affymetrix probeset data:

Annotations for 1636158_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime