Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636160_at:

>probe:Drosophila_2:1636160_at:690:405; Interrogation_Position=1691; Antisense; GACGGCCGTGGCGAATGCAGATACC
>probe:Drosophila_2:1636160_at:479:53; Interrogation_Position=1705; Antisense; ATGCAGATACCAGTTCCGAGGACGA
>probe:Drosophila_2:1636160_at:433:623; Interrogation_Position=1753; Antisense; TGCGAGTTCGAGTTCCCATCACATC
>probe:Drosophila_2:1636160_at:55:431; Interrogation_Position=1829; Antisense; GAGTAGCTCCCTGATCAGCTTGCGT
>probe:Drosophila_2:1636160_at:274:499; Interrogation_Position=1852; Antisense; GTCCGGACCGAAACCTGATTCAGGG
>probe:Drosophila_2:1636160_at:561:603; Interrogation_Position=1867; Antisense; TGATTCAGGGCATGCGTCGATCCCA
>probe:Drosophila_2:1636160_at:375:397; Interrogation_Position=1895; Antisense; GAGCAGGACTAGCTTAACCGCGCCT
>probe:Drosophila_2:1636160_at:493:41; Interrogation_Position=1943; Antisense; ATCGGCAACTGCTGTCACAATGTCC
>probe:Drosophila_2:1636160_at:582:437; Interrogation_Position=1971; Antisense; GAGGAAACGCCTGGCACATCCGGTG
>probe:Drosophila_2:1636160_at:395:115; Interrogation_Position=2014; Antisense; AGCAGGCGCCCTCGGATGATAACAG
>probe:Drosophila_2:1636160_at:710:395; Interrogation_Position=2046; Antisense; GAAATATCCAGCGTATCCATCGATT
>probe:Drosophila_2:1636160_at:145:385; Interrogation_Position=2143; Antisense; GAACTAGTCCTATTCACCATTGCCA
>probe:Drosophila_2:1636160_at:719:127; Interrogation_Position=2158; Antisense; ACCATTGCCAGGTCCAAAACGTCAT
>probe:Drosophila_2:1636160_at:274:497; Interrogation_Position=2178; Antisense; GTCATCCTTCTCCATCATAGTTAAT

Paste this into a BLAST search page for me
GACGGCCGTGGCGAATGCAGATACCATGCAGATACCAGTTCCGAGGACGATGCGAGTTCGAGTTCCCATCACATCGAGTAGCTCCCTGATCAGCTTGCGTGTCCGGACCGAAACCTGATTCAGGGTGATTCAGGGCATGCGTCGATCCCAGAGCAGGACTAGCTTAACCGCGCCTATCGGCAACTGCTGTCACAATGTCCGAGGAAACGCCTGGCACATCCGGTGAGCAGGCGCCCTCGGATGATAACAGGAAATATCCAGCGTATCCATCGATTGAACTAGTCCTATTCACCATTGCCAACCATTGCCAGGTCCAAAACGTCATGTCATCCTTCTCCATCATAGTTAAT

Full Affymetrix probeset data:

Annotations for 1636160_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime