Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636161_at:

>probe:Drosophila_2:1636161_at:726:561; Interrogation_Position=1757; Antisense; GGAATCGGAACTGGACCAAGACCCA
>probe:Drosophila_2:1636161_at:299:213; Interrogation_Position=1774; Antisense; AAGACCCAGCGGATCTCGATGAAGA
>probe:Drosophila_2:1636161_at:348:387; Interrogation_Position=1802; Antisense; GAACAATGGTCGCTCCAGTGTCACC
>probe:Drosophila_2:1636161_at:46:469; Interrogation_Position=1917; Antisense; GTTGAAAACTCGCTGAATCCTCGCC
>probe:Drosophila_2:1636161_at:567:263; Interrogation_Position=1941; Antisense; CAGGGCACCAAACGTCGCTATGAGT
>probe:Drosophila_2:1636161_at:140:681; Interrogation_Position=1959; Antisense; TATGAGTCCGCCCAAGACGATAACA
>probe:Drosophila_2:1636161_at:616:221; Interrogation_Position=2006; Antisense; AAGTGGGTCCAGTGTCATCAGCTGC
>probe:Drosophila_2:1636161_at:28:447; Interrogation_Position=2034; Antisense; GATGCACGCAAGTACCTAAAGCTAC
>probe:Drosophila_2:1636161_at:607:669; Interrogation_Position=2056; Antisense; TACTCGAGGAGTTTGCTCTGTACAA
>probe:Drosophila_2:1636161_at:318:105; Interrogation_Position=2083; Antisense; AGAACTACCGGCTGATTGAGCTGAT
>probe:Drosophila_2:1636161_at:514:725; Interrogation_Position=2098; Antisense; TTGAGCTGATCACACGAGCCGATGA
>probe:Drosophila_2:1636161_at:546:415; Interrogation_Position=2113; Antisense; GAGCCGATGAAGTGATGCGCGAAAT
>probe:Drosophila_2:1636161_at:71:397; Interrogation_Position=2142; Antisense; GACAATGTGCCGTAGAATGCTCCAA
>probe:Drosophila_2:1636161_at:329:271; Interrogation_Position=2261; Antisense; CATCGGTCGGATGCAATCAATCATT

Paste this into a BLAST search page for me
GGAATCGGAACTGGACCAAGACCCAAAGACCCAGCGGATCTCGATGAAGAGAACAATGGTCGCTCCAGTGTCACCGTTGAAAACTCGCTGAATCCTCGCCCAGGGCACCAAACGTCGCTATGAGTTATGAGTCCGCCCAAGACGATAACAAAGTGGGTCCAGTGTCATCAGCTGCGATGCACGCAAGTACCTAAAGCTACTACTCGAGGAGTTTGCTCTGTACAAAGAACTACCGGCTGATTGAGCTGATTTGAGCTGATCACACGAGCCGATGAGAGCCGATGAAGTGATGCGCGAAATGACAATGTGCCGTAGAATGCTCCAACATCGGTCGGATGCAATCAATCATT

Full Affymetrix probeset data:

Annotations for 1636161_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime