FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636163_at:

>probe:Drosophila_2:1636163_at:28:415; Interrogation_Position=1043; Antisense; GACCACACTTATTGCCAGTCAGGAT
>probe:Drosophila_2:1636163_at:696:75; Interrogation_Position=1108; Antisense; AGGTCAAGCTTTTCTTGGGAGCCCT
>probe:Drosophila_2:1636163_at:265:625; Interrogation_Position=1146; Antisense; TGCGCTGAGCTACCATTTATTCTGA
>probe:Drosophila_2:1636163_at:257:699; Interrogation_Position=1161; Antisense; TTTATTCTGATGCACCCGAAGCCAA
>probe:Drosophila_2:1636163_at:49:433; Interrogation_Position=1209; Antisense; GAGGGCTCCATTGAGGCCTAAACTG
>probe:Drosophila_2:1636163_at:468:611; Interrogation_Position=1232; Antisense; TGAAAGGGCTACCTCAACCAACGAA
>probe:Drosophila_2:1636163_at:67:565; Interrogation_Position=1263; Antisense; GGCGTATTTCTACAAGTCAAACCGA
>probe:Drosophila_2:1636163_at:226:231; Interrogation_Position=1323; Antisense; AATGTTCTGAACTGCAGTCGTCGTA
>probe:Drosophila_2:1636163_at:458:85; Interrogation_Position=1338; Antisense; AGTCGTCGTACTTTTCCTATATAGC
>probe:Drosophila_2:1636163_at:327:107; Interrogation_Position=865; Antisense; AGAACGGTCAGTTCCGCAACACGAT
>probe:Drosophila_2:1636163_at:304:187; Interrogation_Position=882; Antisense; AACACGATCGCCTTCATGGAGACGA
>probe:Drosophila_2:1636163_at:410:291; Interrogation_Position=928; Antisense; CGGGATCCAGCCTGCAGAAGGTCAT
>probe:Drosophila_2:1636163_at:544:109; Interrogation_Position=943; Antisense; AGAAGGTCATGTATCTGGTGCCCAC
>probe:Drosophila_2:1636163_at:223:269; Interrogation_Position=991; Antisense; CAGGCATCGCCGTTGAGGGTGATAT

Paste this into a BLAST search page for me
GACCACACTTATTGCCAGTCAGGATAGGTCAAGCTTTTCTTGGGAGCCCTTGCGCTGAGCTACCATTTATTCTGATTTATTCTGATGCACCCGAAGCCAAGAGGGCTCCATTGAGGCCTAAACTGTGAAAGGGCTACCTCAACCAACGAAGGCGTATTTCTACAAGTCAAACCGAAATGTTCTGAACTGCAGTCGTCGTAAGTCGTCGTACTTTTCCTATATAGCAGAACGGTCAGTTCCGCAACACGATAACACGATCGCCTTCATGGAGACGACGGGATCCAGCCTGCAGAAGGTCATAGAAGGTCATGTATCTGGTGCCCACCAGGCATCGCCGTTGAGGGTGATAT

Full Affymetrix probeset data:

Annotations for 1636163_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720