Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636165_at:

>probe:Drosophila_2:1636165_at:256:707; Interrogation_Position=1072; Antisense; TTAGTAAGTGGTTCCCGCAGCAGGC
>probe:Drosophila_2:1636165_at:184:575; Interrogation_Position=1103; Antisense; GGCCCATCCCAATGTAAAACTCTTT
>probe:Drosophila_2:1636165_at:583:141; Interrogation_Position=1135; Antisense; ACGGCGGGCTACTGAGCACTATAGA
>probe:Drosophila_2:1636165_at:245:469; Interrogation_Position=1190; Antisense; GTTGCCCTGCCTATTCGATCAGTTT
>probe:Drosophila_2:1636165_at:488:535; Interrogation_Position=1242; Antisense; GGTCTTGGTTTGGTCCTCAACATAA
>probe:Drosophila_2:1636165_at:435:79; Interrogation_Position=1290; Antisense; AGGTCTACAATTATACGGCTGCTAA
>probe:Drosophila_2:1636165_at:679:259; Interrogation_Position=1346; Antisense; CACGGCTGCCAGATATCGGGATCAA
>probe:Drosophila_2:1636165_at:522:203; Interrogation_Position=1377; Antisense; AAGCCCATGGAAACGGCGATCTGGT
>probe:Drosophila_2:1636165_at:695:411; Interrogation_Position=1403; Antisense; GACCGAGTATGTCCTGTCTCACAAG
>probe:Drosophila_2:1636165_at:236:599; Interrogation_Position=1417; Antisense; TGTCTCACAAGGGAGCTGCTCACAT
>probe:Drosophila_2:1636165_at:164:621; Interrogation_Position=1433; Antisense; TGCTCACATGCAAGTCGCCGGCAAG
>probe:Drosophila_2:1636165_at:246:155; Interrogation_Position=1480; Antisense; ACAGTCTAGATGTCTTCGGCACTTT
>probe:Drosophila_2:1636165_at:442:715; Interrogation_Position=1494; Antisense; TTCGGCACTTTTTTGGTTGGCGCTT
>probe:Drosophila_2:1636165_at:494:463; Interrogation_Position=1509; Antisense; GTTGGCGCTTTAGTTATCCTGGGAA

Paste this into a BLAST search page for me
TTAGTAAGTGGTTCCCGCAGCAGGCGGCCCATCCCAATGTAAAACTCTTTACGGCGGGCTACTGAGCACTATAGAGTTGCCCTGCCTATTCGATCAGTTTGGTCTTGGTTTGGTCCTCAACATAAAGGTCTACAATTATACGGCTGCTAACACGGCTGCCAGATATCGGGATCAAAAGCCCATGGAAACGGCGATCTGGTGACCGAGTATGTCCTGTCTCACAAGTGTCTCACAAGGGAGCTGCTCACATTGCTCACATGCAAGTCGCCGGCAAGACAGTCTAGATGTCTTCGGCACTTTTTCGGCACTTTTTTGGTTGGCGCTTGTTGGCGCTTTAGTTATCCTGGGAA

Full Affymetrix probeset data:

Annotations for 1636165_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime