FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636166_at:

>probe:Drosophila_2:1636166_at:516:451; Interrogation_Position=373; Antisense; GATCGTGGGAAGTCAGTTCTGCGCC
>probe:Drosophila_2:1636166_at:318:469; Interrogation_Position=388; Antisense; GTTCTGCGCCGGAAACTGGAACAGT
>probe:Drosophila_2:1636166_at:726:531; Interrogation_Position=434; Antisense; GGTGGTCCTCTAGGTGCCTTAATTC
>probe:Drosophila_2:1636166_at:60:717; Interrogation_Position=456; Antisense; TTCCCTTTAAGAACTCGAAGCGCTT
>probe:Drosophila_2:1636166_at:227:295; Interrogation_Position=471; Antisense; CGAAGCGCTTCGTCCAAATTGGTAT
>probe:Drosophila_2:1636166_at:90:689; Interrogation_Position=493; Antisense; TATTGCCAGCTTCACAAACCGACAG
>probe:Drosophila_2:1636166_at:339:491; Interrogation_Position=535; Antisense; GTACACGGACGTTATGAGCCACATC
>probe:Drosophila_2:1636166_at:203:127; Interrogation_Position=551; Antisense; AGCCACATCGACTTTATTCTCAAGG
>probe:Drosophila_2:1636166_at:484:223; Interrogation_Position=571; Antisense; CAAGGTTTGGCGTAACTTCGGCAGC
>probe:Drosophila_2:1636166_at:320:491; Interrogation_Position=582; Antisense; GTAACTTCGGCAGCGGTCACAAAAA
>probe:Drosophila_2:1636166_at:158:87; Interrogation_Position=677; Antisense; AGTCCACCGATTACTAGACCACCAG
>probe:Drosophila_2:1636166_at:418:15; Interrogation_Position=810; Antisense; ATTATGATTCGTCTTGGGACTCCCA
>probe:Drosophila_2:1636166_at:87:529; Interrogation_Position=825; Antisense; GGGACTCCCATGAAGGTCATTACGG
>probe:Drosophila_2:1636166_at:73:703; Interrogation_Position=877; Antisense; TTATAGCTCAGAGGGCGATTCGCAC

Paste this into a BLAST search page for me
GATCGTGGGAAGTCAGTTCTGCGCCGTTCTGCGCCGGAAACTGGAACAGTGGTGGTCCTCTAGGTGCCTTAATTCTTCCCTTTAAGAACTCGAAGCGCTTCGAAGCGCTTCGTCCAAATTGGTATTATTGCCAGCTTCACAAACCGACAGGTACACGGACGTTATGAGCCACATCAGCCACATCGACTTTATTCTCAAGGCAAGGTTTGGCGTAACTTCGGCAGCGTAACTTCGGCAGCGGTCACAAAAAAGTCCACCGATTACTAGACCACCAGATTATGATTCGTCTTGGGACTCCCAGGGACTCCCATGAAGGTCATTACGGTTATAGCTCAGAGGGCGATTCGCAC

Full Affymetrix probeset data:

Annotations for 1636166_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720